EMAIL THIS PAGE TO A FRIEND

UBQLN4

ubiquilin 4

Synonyms: A1U A1Up C1orf6 CIP75 UBIN
Gene ID:
Mouse(94232) ubiquilin 4
Rat(310633) ubiquilin 4
Zebrafish(334337) ubiquilin 4
dog(490419) ubiquilin 4
chicken(426353) ubiquilin 4
cow(533021) ubiquilin 4
sheep(101107407) ubiquilin 4
91 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020131 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020131 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020131 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033526 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033526 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033526 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020131 Rosetta Predictions human pricing
NM_001107688 Rosetta Predictions rat pricing
NM_033526 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020131 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085653 predicted 1942
2 SASI_Hs01_00085654 predicted 2015
3 SASI_Hs01_00085656 predicted 655
4 SASI_Hs01_00085658 predicted 733
5 SASI_Hs01_00085659 predicted 719
6 SASI_Hs02_00353005 predicted 1730
7 SASI_Hs01_00085660 predicted 653
8 SASI_Hs01_00085661 predicted 399
9 SASI_Hs01_00085662 predicted 717
10 SASI_Hs02_00353006 predicted 667
11 SASI_Hs01_00085655 predicted 1271
12 SASI_Hs01_00085657 predicted 606
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107688 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231295 predicted 1350
2 SASI_Rn02_00231296 predicted 288
3 SASI_Rn02_00231297 predicted 534
4 SASI_Rn02_00231298 predicted 1928
5 SASI_Rn02_00231299 predicted 2075
6 SASI_Rn02_00231300 predicted 520
7 SASI_Rn02_00231301 predicted 647
8 SASI_Rn02_00231302 predicted 814
9 SASI_Rn02_00231303 predicted 1356
10 SASI_Rn02_00231304 predicted 2009
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033526 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337383 predicted 1713
2 SASI_Mm01_00181147 predicted 708
3 SASI_Mm01_00181148 predicted 2117
4 SASI_Mm01_00181149 predicted 298
5 SASI_Mm01_00181150 predicted 2029
6 SASI_Mm01_00181151 predicted 1728
7 SASI_Mm01_00181152 predicted 820
8 SASI_Mm01_00181153 predicted 2001
9 SASI_Mm01_00181156 predicted 1303
10 SASI_Mm02_00337384 predicted 349
11 SASI_Mm01_00181154 predicted 2091
12 SASI_Mm01_00181155 predicted 2104
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020131
VALIDATED
UBQLN4 MISSION shRNA Bacterial Glycerol Stock
ubiquilin 4
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_020131.3-2490s1c1
Sequence:CCGGCCAGAGGAAATTCGTGTGAAACTCGAGTTTCACACGAATTTCCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_020131.3-490s1c1
Sequence:CCGGGCGTCCATACTCTCTGGCTTTCTCGAGAAAGCCAGAGAGTATGGACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_020131.3-82s1c1
Sequence:CCGGCCCAAGGACAAGGAGGAAATTCTCGAGAATTTCCTCCTTGTCCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_020131.3-1282s1c1
Sequence:CCGGGCTGCTCAGATGATGGTGAATCTCGAGATTCACCATCATCTGAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_020131.3-916s1c1
Sequence:CCGGCGGGAACAGTTTGGCAACAATCTCGAGATTGTTGCCAAACTGTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020131.3-1152s21c1
Sequence:CCGGGATGTTCAATAGCCCAGAAATCTCGAGATTTCTGGGCTATTGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415096    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020131.3-2280s21c1
Sequence:CCGGGCCCAACCAATGCTAGAATTTCTCGAGAAATTCTAGCATTGGTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020131.3-726s21c1
Sequence:CCGGGATCAGCCACATGCTCAATAACTCGAGTTATTGAGCATGTGGCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020131.3-140s21c1
Sequence:CCGGAGGAAATCTCCCGGAGGTTTACTCGAGTAAACCTCCGGGAGATTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020131.3-2048s21c1
Sequence:CCGGTCCTTGAGCAGTGCTACTTAACTCGAGTTAAGTAGCACTGCTCAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020131.3-662s21c1
Sequence:CCGGATCTGATGCGTCACATGATTACTCGAGTAATCATGTGACGCATCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020131
VALIDATED
UBQLN4 MISSION shRNA shRNA Plasmid DNA
ubiquilin 4
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_020131.3-2490s1c1
Sequence:CCGGCCAGAGGAAATTCGTGTGAAACTCGAGTTTCACACGAATTTCCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_020131.3-490s1c1
Sequence:CCGGGCGTCCATACTCTCTGGCTTTCTCGAGAAAGCCAGAGAGTATGGACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_020131.3-82s1c1
Sequence:CCGGCCCAAGGACAAGGAGGAAATTCTCGAGAATTTCCTCCTTGTCCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_020131.3-1282s1c1
Sequence:CCGGGCTGCTCAGATGATGGTGAATCTCGAGATTCACCATCATCTGAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_020131.3-916s1c1
Sequence:CCGGCGGGAACAGTTTGGCAACAATCTCGAGATTGTTGCCAAACTGTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020131.3-1152s21c1
Sequence:CCGGGATGTTCAATAGCCCAGAAATCTCGAGATTTCTGGGCTATTGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415096    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020131.3-2280s21c1
Sequence:CCGGGCCCAACCAATGCTAGAATTTCTCGAGAAATTCTAGCATTGGTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020131.3-726s21c1
Sequence:CCGGGATCAGCCACATGCTCAATAACTCGAGTTATTGAGCATGTGGCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020131.3-140s21c1
Sequence:CCGGAGGAAATCTCCCGGAGGTTTACTCGAGTAAACCTCCGGGAGATTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020131.3-2048s21c1
Sequence:CCGGTCCTTGAGCAGTGCTACTTAACTCGAGTTAAGTAGCACTGCTCAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020131.3-662s21c1
Sequence:CCGGATCTGATGCGTCACATGATTACTCGAGTAATCATGTGACGCATCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020131
VALIDATED
UBQLN4 MISSION shRNA Lentiviral Transduction Particles
ubiquilin 4
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_020131.3-2490s1c1
Sequence:CCGGCCAGAGGAAATTCGTGTGAAACTCGAGTTTCACACGAATTTCCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_020131.3-490s1c1
Sequence:CCGGGCGTCCATACTCTCTGGCTTTCTCGAGAAAGCCAGAGAGTATGGACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_020131.3-82s1c1
Sequence:CCGGCCCAAGGACAAGGAGGAAATTCTCGAGAATTTCCTCCTTGTCCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_020131.3-1282s1c1
Sequence:CCGGGCTGCTCAGATGATGGTGAATCTCGAGATTCACCATCATCTGAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_020131.3-916s1c1
Sequence:CCGGCGGGAACAGTTTGGCAACAATCTCGAGATTGTTGCCAAACTGTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020131.3-1152s21c1
Sequence:CCGGGATGTTCAATAGCCCAGAAATCTCGAGATTTCTGGGCTATTGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415096    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020131.3-2280s21c1
Sequence:CCGGGCCCAACCAATGCTAGAATTTCTCGAGAAATTCTAGCATTGGTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020131.3-726s21c1
Sequence:CCGGGATCAGCCACATGCTCAATAACTCGAGTTATTGAGCATGTGGCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020131.3-140s21c1
Sequence:CCGGAGGAAATCTCCCGGAGGTTTACTCGAGTAAACCTCCGGGAGATTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020131.3-2048s21c1
Sequence:CCGGTCCTTGAGCAGTGCTACTTAACTCGAGTTAAGTAGCACTGCTCAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020131.3-662s21c1
Sequence:CCGGATCTGATGCGTCACATGATTACTCGAGTAATCATGTGACGCATCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033526
UBQLN4 MISSION shRNA Bacterial Glycerol Stock
ubiquilin 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033526.1-2300s1c1
Sequence:CCGGCCAGTTTGAATCTCACTCTTTCTCGAGAAAGAGTGAGATTCAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033526.1-1731s1c1
Sequence:CCGGCCGATGCCAGAAGTGAGATTTCTCGAGAAATCTCACTTCTGGCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033526.1-162s1c1
Sequence:CCGGGAGATCGTGATCTGCGATCAACTCGAGTTGATCGCAGATCACGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033526.1-1293s1c1
Sequence:CCGGCGCACCATGATGCAGACGCTTCTCGAGAAGCGTCTGCATCATGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033526.1-836s1c1
Sequence:CCGGCCCAGCCATGATGCAAGAAATCTCGAGATTTCTTGCATCATGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033526.2-1831s21c1
Sequence:CCGGGGGACATCAATGCCGCTATTGCTCGAGCAATAGCGGCATTGATGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033526.2-2300s21c1
Sequence:CCGGCCAGTTTGAATCTCACTCTTTCTCGAGAAAGAGTGAGATTCAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033526.2-1731s21c1
Sequence:CCGGCCGATGCCAGAAGTGAGATTTCTCGAGAAATCTCACTTCTGGCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033526.2-894s21c1
Sequence:CCGGAGTGTCCCGGGAGGGTATAATCTCGAGATTATACCCTCCCGGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033526
UBQLN4 MISSION shRNA shRNA Plasmid DNA
ubiquilin 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033526.1-2300s1c1
Sequence:CCGGCCAGTTTGAATCTCACTCTTTCTCGAGAAAGAGTGAGATTCAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033526.1-1731s1c1
Sequence:CCGGCCGATGCCAGAAGTGAGATTTCTCGAGAAATCTCACTTCTGGCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033526.1-162s1c1
Sequence:CCGGGAGATCGTGATCTGCGATCAACTCGAGTTGATCGCAGATCACGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033526.1-1293s1c1
Sequence:CCGGCGCACCATGATGCAGACGCTTCTCGAGAAGCGTCTGCATCATGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033526.1-836s1c1
Sequence:CCGGCCCAGCCATGATGCAAGAAATCTCGAGATTTCTTGCATCATGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033526.2-1831s21c1
Sequence:CCGGGGGACATCAATGCCGCTATTGCTCGAGCAATAGCGGCATTGATGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033526.2-2300s21c1
Sequence:CCGGCCAGTTTGAATCTCACTCTTTCTCGAGAAAGAGTGAGATTCAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033526.2-1731s21c1
Sequence:CCGGCCGATGCCAGAAGTGAGATTTCTCGAGAAATCTCACTTCTGGCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033526.2-894s21c1
Sequence:CCGGAGTGTCCCGGGAGGGTATAATCTCGAGATTATACCCTCCCGGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033526
UBQLN4 MISSION shRNA Lentiviral Transduction Particles
ubiquilin 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033526.1-2300s1c1
Sequence:CCGGCCAGTTTGAATCTCACTCTTTCTCGAGAAAGAGTGAGATTCAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033526.1-1731s1c1
Sequence:CCGGCCGATGCCAGAAGTGAGATTTCTCGAGAAATCTCACTTCTGGCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033526.1-162s1c1
Sequence:CCGGGAGATCGTGATCTGCGATCAACTCGAGTTGATCGCAGATCACGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033526.1-1293s1c1
Sequence:CCGGCGCACCATGATGCAGACGCTTCTCGAGAAGCGTCTGCATCATGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033526.1-836s1c1
Sequence:CCGGCCCAGCCATGATGCAAGAAATCTCGAGATTTCTTGCATCATGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033526.2-1831s21c1
Sequence:CCGGGGGACATCAATGCCGCTATTGCTCGAGCAATAGCGGCATTGATGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033526.2-2300s21c1
Sequence:CCGGCCAGTTTGAATCTCACTCTTTCTCGAGAAAGAGTGAGATTCAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033526.2-1731s21c1
Sequence:CCGGCCGATGCCAGAAGTGAGATTTCTCGAGAAATCTCACTTCTGGCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033526.2-894s21c1
Sequence:CCGGAGTGTCCCGGGAGGGTATAATCTCGAGATTATACCCTCCCGGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks