EMAIL THIS PAGE TO A FRIEND

UBQLNL

ubiquilin-like

UniProtKB ID: Q8IYU4, Q6ZRU1, Q96EK3, Q96MB0
Gene ID:
Mouse(244179) ubiquilin-like
Rat(293287) ubiquilin-like
domestic cat(101080480) ubiquilin-like
cow(515028) ubiquilin-like
sheep(101120191) ubiquilin-like
112 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145053 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145053 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145053 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198624 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198624 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198624 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU119801 MISSION® esiRNA esiRNA human UBQLNL (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145053 Rosetta Predictions human pricing
NM_001013899 Rosetta Predictions rat pricing
NM_198624 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145053 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197827 predicted 1328
2 SASI_Hs01_00197828 predicted 1064
3 SASI_Hs02_00364937 predicted 1511
4 SASI_Hs02_00364938 predicted 1318
5 SASI_Hs01_00197832 predicted 701
6 SASI_Hs02_00364939 predicted 353
7 SASI_Hs01_00197833 predicted 1358
8 SASI_Hs01_00197834 predicted 1097
9 SASI_Hs01_00197836 predicted 1050
10 SASI_Hs02_00364940 predicted 1689
11 SASI_Hs01_00197829 predicted 427
12 SASI_Hs01_00197830 predicted 1542
13 SASI_Hs01_00197831 predicted 461
14 SASI_Hs01_00197835 predicted 1576
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013899 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120025 predicted 1256
2 SASI_Rn02_00201180 predicted 754
3 SASI_Rn01_00120026 predicted 1818
4 SASI_Rn01_00120027 predicted 1376
5 SASI_Rn01_00120029 predicted 803
6 SASI_Rn01_00120030 predicted 1023
7 SASI_Rn01_00120031 predicted 1231
8 SASI_Rn01_00120032 predicted 1920
9 SASI_Rn01_00120033 predicted 637
10 SASI_Rn01_00120034 predicted 335
11 SASI_Rn01_00120028 predicted 1437
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198624 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037213 predicted 430
2 SASI_Mm02_00351072 predicted 1386
3 SASI_Mm02_00351073 predicted 1867
4 SASI_Mm01_00037215 predicted 1076
5 SASI_Mm01_00037216 predicted 668
6 SASI_Mm01_00037218 predicted 1045
7 SASI_Mm01_00037219 predicted 626
8 SASI_Mm02_00351074 predicted 683
9 SASI_Mm01_00037220 predicted 860
10 SASI_Mm01_00037221 predicted 2040
11 SASI_Mm01_00037214 predicted 1392
12 SASI_Mm01_00037217 predicted 2044
13 SASI_Mm01_00037222 predicted 417
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145053
VALIDATED
UBQLNL MISSION shRNA Bacterial Glycerol Stock
ubiquilin-like
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145053.4-876s21c1
Sequence:CCGGACATCTAGACACGCAACAATTCTCGAGAATTGTTGCGTGTCTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235457    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145053.4-1934s21c1
Sequence:CCGGAGTCCTGCAGAGGCTACAATCCTCGAGGATTGTAGCCTCTGCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145053.4-933s21c1
Sequence:CCGGTGATAATTCTGAGATCCTATTCTCGAGAATAGGATCTCAGAATTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145053.4-1266s21c1
Sequence:CCGGTGCAACCCGAGTCATCTATAACTCGAGTTATAGATGACTCGGGTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145053.4-1107s21c1
Sequence:CCGGTGCTGATATCAATGATCAAATCTCGAGATTTGATCATTGATATCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011152    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_145053.2-2294s1c1
Sequence:CCGGGCTCAAGAGATCCCAGAGATTCTCGAGAATCTCTGGGATCTCTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_145053.2-750s1c1
Sequence:CCGGCCACACCATCTACTTGGTCATCTCGAGATGACCAAGTAGATGGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145053.2-279s1c1
Sequence:CCGGCCTCACCAAATGGATACAGAACTCGAGTTCTGTATCCATTTGGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_145053.2-1366s1c1
Sequence:CCGGGCAGGACAAGTGCTAGAACAACTCGAGTTGTTCTAGCACTTGTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_145053.2-1106s1c1
Sequence:CCGGCCCGCCTTCTTCTTGATAATTCTCGAGAATTATCAAGAAGAAGGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145053
VALIDATED
UBQLNL MISSION shRNA shRNA Plasmid DNA
ubiquilin-like
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145053.4-876s21c1
Sequence:CCGGACATCTAGACACGCAACAATTCTCGAGAATTGTTGCGTGTCTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235457    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145053.4-1934s21c1
Sequence:CCGGAGTCCTGCAGAGGCTACAATCCTCGAGGATTGTAGCCTCTGCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145053.4-933s21c1
Sequence:CCGGTGATAATTCTGAGATCCTATTCTCGAGAATAGGATCTCAGAATTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145053.4-1266s21c1
Sequence:CCGGTGCAACCCGAGTCATCTATAACTCGAGTTATAGATGACTCGGGTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145053.4-1107s21c1
Sequence:CCGGTGCTGATATCAATGATCAAATCTCGAGATTTGATCATTGATATCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011152    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_145053.2-2294s1c1
Sequence:CCGGGCTCAAGAGATCCCAGAGATTCTCGAGAATCTCTGGGATCTCTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_145053.2-750s1c1
Sequence:CCGGCCACACCATCTACTTGGTCATCTCGAGATGACCAAGTAGATGGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145053.2-279s1c1
Sequence:CCGGCCTCACCAAATGGATACAGAACTCGAGTTCTGTATCCATTTGGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_145053.2-1366s1c1
Sequence:CCGGGCAGGACAAGTGCTAGAACAACTCGAGTTGTTCTAGCACTTGTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_145053.2-1106s1c1
Sequence:CCGGCCCGCCTTCTTCTTGATAATTCTCGAGAATTATCAAGAAGAAGGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145053
VALIDATED
UBQLNL MISSION shRNA Lentiviral Transduction Particles
ubiquilin-like
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145053.4-876s21c1
Sequence:CCGGACATCTAGACACGCAACAATTCTCGAGAATTGTTGCGTGTCTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235457    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145053.4-1934s21c1
Sequence:CCGGAGTCCTGCAGAGGCTACAATCCTCGAGGATTGTAGCCTCTGCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145053.4-933s21c1
Sequence:CCGGTGATAATTCTGAGATCCTATTCTCGAGAATAGGATCTCAGAATTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145053.4-1266s21c1
Sequence:CCGGTGCAACCCGAGTCATCTATAACTCGAGTTATAGATGACTCGGGTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145053.4-1107s21c1
Sequence:CCGGTGCTGATATCAATGATCAAATCTCGAGATTTGATCATTGATATCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011152    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_145053.2-2294s1c1
Sequence:CCGGGCTCAAGAGATCCCAGAGATTCTCGAGAATCTCTGGGATCTCTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_145053.2-750s1c1
Sequence:CCGGCCACACCATCTACTTGGTCATCTCGAGATGACCAAGTAGATGGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145053.2-279s1c1
Sequence:CCGGCCTCACCAAATGGATACAGAACTCGAGTTCTGTATCCATTTGGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_145053.2-1366s1c1
Sequence:CCGGGCAGGACAAGTGCTAGAACAACTCGAGTTGTTCTAGCACTTGTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_145053.2-1106s1c1
Sequence:CCGGCCCGCCTTCTTCTTGATAATTCTCGAGAATTATCAAGAAGAAGGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198624
UBQLNL MISSION shRNA Bacterial Glycerol Stock
ubiquilin-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198624.1-1755s1c1
Sequence:CCGGCCTACATTGAACCTTACCTATCTCGAGATAGGTAAGGTTCAATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198624.1-341s1c1
Sequence:CCGGCCAGGTGTCATTCGAGTGATTCTCGAGAATCACTCGAATGACACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198624.1-674s1c1
Sequence:CCGGGCAGGCATGAATGAAACTAAACTCGAGTTTAGTTTCATTCATGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086763    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198624.1-2105s1c1
Sequence:CCGGCCCATCTGCTTTCTACTGCATCTCGAGATGCAGTAGAAAGCAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198624.1-1181s1c1
Sequence:CCGGCCTTCTCTATCTCAACCATTACTCGAGTAATGGTTGAGATAGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198624
UBQLNL MISSION shRNA shRNA Plasmid DNA
ubiquilin-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198624.1-1755s1c1
Sequence:CCGGCCTACATTGAACCTTACCTATCTCGAGATAGGTAAGGTTCAATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198624.1-341s1c1
Sequence:CCGGCCAGGTGTCATTCGAGTGATTCTCGAGAATCACTCGAATGACACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198624.1-674s1c1
Sequence:CCGGGCAGGCATGAATGAAACTAAACTCGAGTTTAGTTTCATTCATGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086763    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198624.1-2105s1c1
Sequence:CCGGCCCATCTGCTTTCTACTGCATCTCGAGATGCAGTAGAAAGCAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198624.1-1181s1c1
Sequence:CCGGCCTTCTCTATCTCAACCATTACTCGAGTAATGGTTGAGATAGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198624
UBQLNL MISSION shRNA Lentiviral Transduction Particles
ubiquilin-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198624.1-1755s1c1
Sequence:CCGGCCTACATTGAACCTTACCTATCTCGAGATAGGTAAGGTTCAATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198624.1-341s1c1
Sequence:CCGGCCAGGTGTCATTCGAGTGATTCTCGAGAATCACTCGAATGACACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198624.1-674s1c1
Sequence:CCGGGCAGGCATGAATGAAACTAAACTCGAGTTTAGTTTCATTCATGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086763    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198624.1-2105s1c1
Sequence:CCGGCCCATCTGCTTTCTACTGCATCTCGAGATGCAGTAGAAAGCAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198624.1-1181s1c1
Sequence:CCGGCCTTCTCTATCTCAACCATTACTCGAGTAATGGTTGAGATAGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks