EMAIL THIS PAGE TO A FRIEND

UBR1

ubiquitin protein ligase E3 component n-recognin 1

Synonyms: JBS
Gene ID:
Human(197131) Summary: The N-end rule pathway is one proteolytic pathway of the ubiquitin system. The recognition component of this pathway, encoded by this gene, binds to a destabilizing N-terminal residue of a substrate protein and participates in the formation of a substrate-linked multiubiquitin chain. This leads to the eventual degradation of the substrate protein. The protein described in this record has a RING-type zinc finger and a UBR-type zinc finger. Mutations in this gene have been associated with Johanson-Blizzard syndrome. [provided by RefSeq, Jul 2008]
Mouse(22222) ubiquitin protein ligase E3 component n-recognin 1
Rat(499877) ubiquitin protein ligase E3 component n-recognin 1
Zebrafish(568531) ubiquitin protein ligase E3 component n-recognin 1
Horse(100056497) ubiquitin protein ligase E3 component n-recognin 1
domestic cat(101081553) ubiquitin protein ligase E3 component n-recognin 1
dog(487521) ubiquitin protein ligase E3 component n-recognin 1
chicken(423242) ubiquitin protein ligase E3 component n-recognin 1
cow(522464) ubiquitin protein ligase E3 component n-recognin 1
sheep(101119567) ubiquitin protein ligase E3 component n-recognin 1
Domestic Rabbit(100338337) ubiquitin protein ligase E3 component n-recognin 1
naked mole-rat(101719904) ubiquitin protein ligase E3 component n-recognin 1
domestic guinea pig(100715624) ubiquitin protein ligase E3 component n-recognin 1
221 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174916 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174916 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174916 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009461 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009461 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009461 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU053301 MISSION® esiRNA esiRNA human UBR1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174916 Rosetta Predictions human pricing
XM_001080919 Rosetta Predictions rat pricing
XM_575219 Rosetta Predictions rat pricing
NM_009461 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174916 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368829 predicted 2738
2 SASI_Hs01_00102297 predicted 768
3 SASI_Hs01_00102298 predicted 4238
4 SASI_Hs01_00102299 predicted 2750
5 SASI_Hs01_00102300 predicted 1852
6 SASI_Hs01_00102301 predicted 1809
7 SASI_Hs01_00102304 predicted 469
8 SASI_Hs02_00368830 predicted 2068
9 SASI_Hs02_00368831 predicted 3787
10 SASI_Hs02_00368832 predicted 405
11 SASI_Hs01_00102295 predicted 1748
12 SASI_Hs01_00102296 predicted 2179
13 SASI_Hs01_00102302 predicted 5229
14 SASI_Hs01_00102303 predicted 1981
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080919 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00369820 predicted 1151
2 SASI_Rn02_00369821 predicted 1135
3 SASI_Rn02_00369822 predicted 5415
4 SASI_Rn02_00369823 predicted 368
5 SASI_Rn02_00369824 predicted 2376
6 SASI_Rn02_00369825 predicted 859
7 SASI_Rn02_00369826 predicted 5164
8 SASI_Rn02_00369827 predicted 628
9 SASI_Rn02_00369828 predicted 1191
10 SASI_Rn02_00369829 predicted 1690
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575219 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00137794 predicted 2874
2 SASI_Rn01_00137795 predicted 2932
3 SASI_Rn01_00137796 predicted 2870
4 SASI_Rn01_00137797 predicted 2946
5 SASI_Rn01_00137798 predicted 2881
6 SASI_Rn01_00137799 predicted 2977
7 SASI_Rn01_00137800 predicted 2994
8 SASI_Rn01_00137801 predicted 2879
9 SASI_Rn01_00137802 predicted 2876
10 SASI_Rn01_00137803 predicted 3046
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009461 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054189 predicted 4401
2 SASI_Mm01_00054190 predicted 1226
3 SASI_Mm02_00316182 predicted 1174
4 SASI_Mm02_00316183 predicted 1161
5 SASI_Mm01_00054191 predicted 1783
6 SASI_Mm01_00054192 predicted 1535
7 SASI_Mm01_00054193 predicted 1853
8 SASI_Mm02_00316184 predicted 634
9 SASI_Mm02_00316185 predicted 5466
10 SASI_Mm01_00054194 predicted 3263
11 SASI_Mm01_00054188 predicted 3844
12 SASI_Mm01_00054195 predicted 2598
13 SASI_Mm01_00054196 predicted 4968
14 SASI_Mm01_00054197 predicted 515
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174916
UBR1 MISSION shRNA Bacterial Glycerol Stock
ubiquitin protein ligase E3 component n-recognin 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174916.x-3836s1c1
Sequence:CCGGGCGTTGAGTCTTCGATTAAATCTCGAGATTTAATCGAAGACTCAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174916.x-3976s1c1
Sequence:CCGGGCTTTCACTATCCAGGCAATTCTCGAGAATTGCCTGGATAGTGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174916.x-1846s1c1
Sequence:CCGGGCTGGTCTTCATGTACGTTTACTCGAGTAAACGTACATGAAGACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174916.x-5202s1c1
Sequence:CCGGCCAAGAGACTAATCAGATGTTCTCGAGAACATCTGATTAGTCTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174916.x-2048s1c1
Sequence:CCGGGCAGAGAAGAAATGTATGATACTCGAGTATCATACATTTCTTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174916.2-2743s21c1
Sequence:CCGGACCGTATTTGAGCGGGCAATACTCGAGTATTGCCCGCTCAAATACGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174916.2-3063s21c1
Sequence:CCGGATCAGGATCGGAATCTATTAACTCGAGTTAATAGATTCCGATCCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174916
UBR1 MISSION shRNA shRNA Plasmid DNA
ubiquitin protein ligase E3 component n-recognin 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174916.x-3836s1c1
Sequence:CCGGGCGTTGAGTCTTCGATTAAATCTCGAGATTTAATCGAAGACTCAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174916.x-3976s1c1
Sequence:CCGGGCTTTCACTATCCAGGCAATTCTCGAGAATTGCCTGGATAGTGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174916.x-1846s1c1
Sequence:CCGGGCTGGTCTTCATGTACGTTTACTCGAGTAAACGTACATGAAGACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174916.x-5202s1c1
Sequence:CCGGCCAAGAGACTAATCAGATGTTCTCGAGAACATCTGATTAGTCTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174916.x-2048s1c1
Sequence:CCGGGCAGAGAAGAAATGTATGATACTCGAGTATCATACATTTCTTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174916.2-2743s21c1
Sequence:CCGGACCGTATTTGAGCGGGCAATACTCGAGTATTGCCCGCTCAAATACGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174916.2-3063s21c1
Sequence:CCGGATCAGGATCGGAATCTATTAACTCGAGTTAATAGATTCCGATCCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174916
UBR1 MISSION shRNA Lentiviral Transduction Particles
ubiquitin protein ligase E3 component n-recognin 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174916.x-3836s1c1
Sequence:CCGGGCGTTGAGTCTTCGATTAAATCTCGAGATTTAATCGAAGACTCAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174916.x-3976s1c1
Sequence:CCGGGCTTTCACTATCCAGGCAATTCTCGAGAATTGCCTGGATAGTGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174916.x-1846s1c1
Sequence:CCGGGCTGGTCTTCATGTACGTTTACTCGAGTAAACGTACATGAAGACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174916.x-5202s1c1
Sequence:CCGGCCAAGAGACTAATCAGATGTTCTCGAGAACATCTGATTAGTCTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174916.x-2048s1c1
Sequence:CCGGGCAGAGAAGAAATGTATGATACTCGAGTATCATACATTTCTTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174916.2-2743s21c1
Sequence:CCGGACCGTATTTGAGCGGGCAATACTCGAGTATTGCCCGCTCAAATACGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174916.2-3063s21c1
Sequence:CCGGATCAGGATCGGAATCTATTAACTCGAGTTAATAGATTCCGATCCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009461
VALIDATED
UBR1 MISSION shRNA Bacterial Glycerol Stock
ubiquitin protein ligase E3 component n-recognin 1
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009461.1-5774s1c1
Sequence:CCGGGCACCTTTGTATTTGGTGTTTCTCGAGAAACACCAAATACAAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009461.1-1533s1c1
Sequence:CCGGCGCAGTTATATGTGACCTAAACTCGAGTTTAGGTCACATATAACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009461.1-361s1c1
Sequence:CCGGCCGGATATTTGCTTAGAGAAACTCGAGTTTCTCTAAGCAAATATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009461.1-2301s1c1
Sequence:CCGGCCAGGATTTGATTAAACAGTACTCGAGTACTGTTTAATCAAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009461.1-4406s1c1
Sequence:CCGGCGCCACTTAGTTCTTCATATACTCGAGTATATGAAGAACTAAGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009461.2-688s21c1
Sequence:CCGGGAATATTCCCTTCGGTGATAACTCGAGTTATCACCGAAGGGAATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009461.2-1960s21c1
Sequence:CCGGCTGGTCTTCATGTACGTTTAACTCGAGTTAAACGTACATGAAGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009461.2-3842s21c1
Sequence:CCGGTGCCAGAATATCGGGTTATAACTCGAGTTATAACCCGATATTCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009461.2-2398s21c1
Sequence:CCGGTTACCAGAGAGGAGGTTATAACTCGAGTTATAACCTCCTCTCTGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009461.2-5680s21c1
Sequence:CCGGCATAACTGTCCTAGTTCATTTCTCGAGAAATGAACTAGGACAGTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009461.2-889s21c1
Sequence:CCGGACACGACTGCCATCGACAAAGCTCGAGCTTTGTCGATGGCAGTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009461.2-5834s21c1
Sequence:CCGGGATCACCTGTGATGGTCTAAACTCGAGTTTAGACCATCACAGGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009461.2-349s21c1
Sequence:CCGGTTGGAGAGGATCCGGATATTTCTCGAGAAATATCCGGATCCTCTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009461
VALIDATED
UBR1 MISSION shRNA shRNA Plasmid DNA
ubiquitin protein ligase E3 component n-recognin 1
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009461.1-5774s1c1
Sequence:CCGGGCACCTTTGTATTTGGTGTTTCTCGAGAAACACCAAATACAAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009461.1-1533s1c1
Sequence:CCGGCGCAGTTATATGTGACCTAAACTCGAGTTTAGGTCACATATAACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009461.1-361s1c1
Sequence:CCGGCCGGATATTTGCTTAGAGAAACTCGAGTTTCTCTAAGCAAATATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009461.1-2301s1c1
Sequence:CCGGCCAGGATTTGATTAAACAGTACTCGAGTACTGTTTAATCAAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009461.1-4406s1c1
Sequence:CCGGCGCCACTTAGTTCTTCATATACTCGAGTATATGAAGAACTAAGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009461.2-688s21c1
Sequence:CCGGGAATATTCCCTTCGGTGATAACTCGAGTTATCACCGAAGGGAATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009461.2-1960s21c1
Sequence:CCGGCTGGTCTTCATGTACGTTTAACTCGAGTTAAACGTACATGAAGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009461.2-3842s21c1
Sequence:CCGGTGCCAGAATATCGGGTTATAACTCGAGTTATAACCCGATATTCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009461.2-2398s21c1
Sequence:CCGGTTACCAGAGAGGAGGTTATAACTCGAGTTATAACCTCCTCTCTGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009461.2-5680s21c1
Sequence:CCGGCATAACTGTCCTAGTTCATTTCTCGAGAAATGAACTAGGACAGTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009461.2-889s21c1
Sequence:CCGGACACGACTGCCATCGACAAAGCTCGAGCTTTGTCGATGGCAGTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009461.2-5834s21c1
Sequence:CCGGGATCACCTGTGATGGTCTAAACTCGAGTTTAGACCATCACAGGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009461.2-349s21c1
Sequence:CCGGTTGGAGAGGATCCGGATATTTCTCGAGAAATATCCGGATCCTCTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009461
VALIDATED
UBR1 MISSION shRNA Lentiviral Transduction Particles
ubiquitin protein ligase E3 component n-recognin 1
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009461.1-5774s1c1
Sequence:CCGGGCACCTTTGTATTTGGTGTTTCTCGAGAAACACCAAATACAAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009461.1-1533s1c1
Sequence:CCGGCGCAGTTATATGTGACCTAAACTCGAGTTTAGGTCACATATAACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009461.1-361s1c1
Sequence:CCGGCCGGATATTTGCTTAGAGAAACTCGAGTTTCTCTAAGCAAATATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009461.1-2301s1c1
Sequence:CCGGCCAGGATTTGATTAAACAGTACTCGAGTACTGTTTAATCAAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009461.1-4406s1c1
Sequence:CCGGCGCCACTTAGTTCTTCATATACTCGAGTATATGAAGAACTAAGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009461.2-688s21c1
Sequence:CCGGGAATATTCCCTTCGGTGATAACTCGAGTTATCACCGAAGGGAATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009461.2-1960s21c1
Sequence:CCGGCTGGTCTTCATGTACGTTTAACTCGAGTTAAACGTACATGAAGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009461.2-3842s21c1
Sequence:CCGGTGCCAGAATATCGGGTTATAACTCGAGTTATAACCCGATATTCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009461.2-2398s21c1
Sequence:CCGGTTACCAGAGAGGAGGTTATAACTCGAGTTATAACCTCCTCTCTGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009461.2-5680s21c1
Sequence:CCGGCATAACTGTCCTAGTTCATTTCTCGAGAAATGAACTAGGACAGTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009461.2-889s21c1
Sequence:CCGGACACGACTGCCATCGACAAAGCTCGAGCTTTGTCGATGGCAGTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009461.2-5834s21c1
Sequence:CCGGGATCACCTGTGATGGTCTAAACTCGAGTTTAGACCATCACAGGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009461.2-349s21c1
Sequence:CCGGTTGGAGAGGATCCGGATATTTCTCGAGAAATATCCGGATCCTCTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks