EMAIL THIS PAGE TO A FRIEND

UBR2

ubiquitin protein ligase E3 component n-recognin 2

Synonyms: C6orf133 RP3-392M17.3 bA49A4.1 dJ242G1.1 dJ392M17.3
UniProtKB ID: Q8IWV8, O15057, Q4VXK2, Q5TFH6, Q6P2I2, Q6ZUD0
Gene ID:
Human(23304) Summary: This gene encodes an E3 ubiquitin ligase of the N-end rule proteolytic pathway that targets proteins with destabilizing N-terminal residues for polyubiquitylation and proteasome-mediated degradation. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
Mouse(224826) ubiquitin protein ligase E3 component n-recognin 2
Rat(363188) ubiquitin protein ligase E3 component n-recognin 2
domestic guinea pig(100713673) ubiquitin protein ligase E3 component n-recognin 2
naked mole-rat(101703005) ubiquitin protein ligase E3 component n-recognin 2
Domestic Rabbit(100340842) ubiquitin protein ligase E3 component n-recognin 2
cow(527153) ubiquitin protein ligase E3 component n-recognin 2
sheep(101109127) ubiquitin protein ligase E3 component n-recognin 2
Zebrafish(559136) ubiquitin protein ligase E3 component n-recognin 2
chicken(421387) ubiquitin protein ligase E3 component n-recognin 2
Horse(100054695) ubiquitin protein ligase E3 component n-recognin 2
domestic cat(101081546) ubiquitin protein ligase E3 component n-recognin 2
dog(474903) ubiquitin protein ligase E3 component n-recognin 2
116 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015255 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015255 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015255 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146078 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146078 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146078 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015255 Rosetta Predictions human pricing
XM_001061775 Rosetta Predictions rat pricing
XM_001061828 Rosetta Predictions rat pricing
XM_001061882 Rosetta Predictions rat pricing
XM_343528 Rosetta Predictions rat pricing
NM_146078 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015255 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131879 predicted 4334
2 SASI_Hs01_00131881 predicted 3297
3 SASI_Hs01_00131883 predicted 1409
4 SASI_Hs01_00131884 predicted 341
5 SASI_Hs01_00131885 predicted 2063
6 SASI_Hs01_00131886 predicted 709
7 SASI_Hs01_00131887 predicted 1452
8 SASI_Hs02_00347393 predicted 3492
9 SASI_Hs02_00347394 predicted 1281
10 SASI_Hs02_00347395 predicted 2930
11 SASI_Hs01_00131880 predicted 1954
12 SASI_Hs01_00131882 predicted 4655
13 SASI_Hs01_00131888 predicted 2736
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061775 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00301295 predicted 3432
2 SASI_Rn02_00301296 predicted 1826
3 SASI_Rn02_00301297 predicted 3068
4 SASI_Rn02_00301298 predicted 2181
5 SASI_Rn02_00301299 predicted 5901
6 SASI_Rn02_00301300 predicted 3302
7 SASI_Rn02_00301301 predicted 3324
8 SASI_Rn02_00301302 predicted 5040
9 SASI_Rn02_00301303 predicted 4105
10 SASI_Rn02_00301304 predicted 3054
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061828 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00301448 predicted 1714
2 SASI_Rn02_00301449 predicted 2957
3 SASI_Rn02_00301450 predicted 5786
4 SASI_Rn02_00301451 predicted 3189
5 SASI_Rn02_00301452 predicted 1555
6 SASI_Rn02_00301453 predicted 3215
7 SASI_Rn02_00301454 predicted 4933
8 SASI_Rn02_00301455 predicted 3992
9 SASI_Rn02_00301456 predicted 2939
10 SASI_Rn02_00301457 predicted 4368
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061882 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00301624 predicted 1716
2 SASI_Rn02_00301625 predicted 2957
3 SASI_Rn02_00301626 predicted 5789
4 SASI_Rn02_00301627 predicted 3189
5 SASI_Rn02_00301628 predicted 1559
6 SASI_Rn02_00301629 predicted 3208
7 SASI_Rn02_00301630 predicted 4933
8 SASI_Rn02_00301631 predicted 3988
9 SASI_Rn02_00301632 predicted 2947
10 SASI_Rn02_00301633 predicted 4363
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343528 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00135955 predicted 1168
2 SASI_Rn01_00135956 predicted 3874
3 SASI_Rn01_00135957 predicted 2647
4 SASI_Rn01_00135958 predicted 1961
5 SASI_Rn01_00135959 predicted 2660
6 SASI_Rn01_00135960 predicted 4381
7 SASI_Rn01_00135961 predicted 3440
8 SASI_Rn01_00135962 predicted 2281
9 SASI_Rn01_00135963 predicted 2390
10 SASI_Rn01_00135964 predicted 3815
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146078 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199451 predicted 3626
2 SASI_Mm02_00341711 predicted 3649
3 SASI_Mm01_00199453 predicted 5363
4 SASI_Mm02_00341712 predicted 4856
5 SASI_Mm01_00199454 predicted 5208
6 SASI_Mm01_00199456 predicted 2063
7 SASI_Mm01_00199457 predicted 1989
8 SASI_Mm01_00199458 predicted 4778
9 SASI_Mm02_00341713 predicted 812
10 SASI_Mm01_00199459 predicted 4052
11 SASI_Mm01_00199452 predicted 845
12 SASI_Mm01_00199455 predicted 4916
13 SASI_Mm01_00199460 predicted 3914
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015255
UBR2 MISSION shRNA Bacterial Glycerol Stock
ubiquitin protein ligase E3 component n-recognin 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000413906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015255.1-1563s21c1
Sequence:CCGGACGTCAAGTAGGACAACATATCTCGAGATATGTTGTCCTACTTGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015255.x-5083s1c1
Sequence:CCGGCCTCCTTACCTTGATGACTATCTCGAGATAGTCATCAAGGTAAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015255.x-4009s1c1
Sequence:CCGGGCGTACACCATCCAAAGCATACTCGAGTATGCTTTGGATGGTGTACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015255.x-2786s1c1
Sequence:CCGGGCATGGCACTACAAGAAGAAACTCGAGTTTCTTCTTGTAGTGCCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015255.x-1990s1c1
Sequence:CCGGGCCGGAATGTGGAGAAGAAATCTCGAGATTTCTTCTCCACATTCCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015255.x-3633s1c1
Sequence:CCGGCCTTTGTGAATGCTTGAGTAACTCGAGTTACTCAAGCATTCACAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015255
UBR2 MISSION shRNA shRNA Plasmid DNA
ubiquitin protein ligase E3 component n-recognin 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000413906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015255.1-1563s21c1
Sequence:CCGGACGTCAAGTAGGACAACATATCTCGAGATATGTTGTCCTACTTGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015255.x-5083s1c1
Sequence:CCGGCCTCCTTACCTTGATGACTATCTCGAGATAGTCATCAAGGTAAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015255.x-4009s1c1
Sequence:CCGGGCGTACACCATCCAAAGCATACTCGAGTATGCTTTGGATGGTGTACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015255.x-2786s1c1
Sequence:CCGGGCATGGCACTACAAGAAGAAACTCGAGTTTCTTCTTGTAGTGCCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015255.x-1990s1c1
Sequence:CCGGGCCGGAATGTGGAGAAGAAATCTCGAGATTTCTTCTCCACATTCCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015255.x-3633s1c1
Sequence:CCGGCCTTTGTGAATGCTTGAGTAACTCGAGTTACTCAAGCATTCACAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015255
UBR2 MISSION shRNA Lentiviral Transduction Particles
ubiquitin protein ligase E3 component n-recognin 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000413906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015255.1-1563s21c1
Sequence:CCGGACGTCAAGTAGGACAACATATCTCGAGATATGTTGTCCTACTTGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015255.x-5083s1c1
Sequence:CCGGCCTCCTTACCTTGATGACTATCTCGAGATAGTCATCAAGGTAAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015255.x-4009s1c1
Sequence:CCGGGCGTACACCATCCAAAGCATACTCGAGTATGCTTTGGATGGTGTACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015255.x-2786s1c1
Sequence:CCGGGCATGGCACTACAAGAAGAAACTCGAGTTTCTTCTTGTAGTGCCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015255.x-1990s1c1
Sequence:CCGGGCCGGAATGTGGAGAAGAAATCTCGAGATTTCTTCTCCACATTCCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015255.x-3633s1c1
Sequence:CCGGCCTTTGTGAATGCTTGAGTAACTCGAGTTACTCAAGCATTCACAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146078
VALIDATED
UBR2 MISSION shRNA Bacterial Glycerol Stock
ubiquitin protein ligase E3 component n-recognin 2
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215931    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146078.2-5945s1c1
Sequence:CCGGCTTTGAAAGCATTACTCAATTCTCGAGAATTGAGTAATGCTTTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146078.2-4012s1c1
Sequence:CCGGCCCATATTCTGATAGCATAAACTCGAGTTTATGCTATCAGAATATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217252    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146078.2-5822s1c1
Sequence:CCGGCCAGAGCAAAGCAAGTCAATTCTCGAGAATTGACTTGCTTTGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146078.2-1982s21c1
Sequence:CCGGGCAGGTTTGCATGTATTGTTACTCGAGTAACAATACATGCAAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146078.2-5253s21c1
Sequence:CCGGGACGAGGAAATCCTTTACATTCTCGAGAATGTAAAGGATTTCCTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146078.2-4265s21c1
Sequence:CCGGGCGTTACTTCCTGTGGTACAACTCGAGTTGTACCACAGGAAGTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293096    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146078.2-5448s21c1
Sequence:CCGGCCAGAAAGACAACAGGAAATACTCGAGTATTTCCTGTTGTCTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194615    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146078.2-3647s1c1
Sequence:CCGGGCCCATTGTTGGCAAAGGTATCTCGAGATACCTTTGCCAACAATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194475    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146078.2-908s1c1
Sequence:CCGGGCAACTACAGTTGATCGAGATCTCGAGATCTCGATCAACTGTAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194410    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146078.2-2060s1c1
Sequence:CCGGCCACCCATGTTGATAGAACATCTCGAGATGTTCTATCAACATGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146078.2-5253s1c1
Sequence:CCGGGACGAGGAAATCCTTTACATTCTCGAGAATGTAAAGGATTTCCTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146078.2-1982s1c1
Sequence:CCGGGCAGGTTTGCATGTATTGTTACTCGAGTAACAATACATGCAAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175322    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146078.2-5448s1c1
Sequence:CCGGCCAGAAAGACAACAGGAAATACTCGAGTATTTCCTGTTGTCTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146078.2-4265s1c1
Sequence:CCGGGCGTTACTTCCTGTGGTACAACTCGAGTTGTACCACAGGAAGTAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146078
VALIDATED
UBR2 MISSION shRNA shRNA Plasmid DNA
ubiquitin protein ligase E3 component n-recognin 2
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215931    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146078.2-5945s1c1
Sequence:CCGGCTTTGAAAGCATTACTCAATTCTCGAGAATTGAGTAATGCTTTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146078.2-4012s1c1
Sequence:CCGGCCCATATTCTGATAGCATAAACTCGAGTTTATGCTATCAGAATATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217252    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146078.2-5822s1c1
Sequence:CCGGCCAGAGCAAAGCAAGTCAATTCTCGAGAATTGACTTGCTTTGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146078.2-1982s21c1
Sequence:CCGGGCAGGTTTGCATGTATTGTTACTCGAGTAACAATACATGCAAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146078.2-5253s21c1
Sequence:CCGGGACGAGGAAATCCTTTACATTCTCGAGAATGTAAAGGATTTCCTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146078.2-4265s21c1
Sequence:CCGGGCGTTACTTCCTGTGGTACAACTCGAGTTGTACCACAGGAAGTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293096    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146078.2-5448s21c1
Sequence:CCGGCCAGAAAGACAACAGGAAATACTCGAGTATTTCCTGTTGTCTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194615    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146078.2-3647s1c1
Sequence:CCGGGCCCATTGTTGGCAAAGGTATCTCGAGATACCTTTGCCAACAATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194475    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146078.2-908s1c1
Sequence:CCGGGCAACTACAGTTGATCGAGATCTCGAGATCTCGATCAACTGTAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194410    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146078.2-2060s1c1
Sequence:CCGGCCACCCATGTTGATAGAACATCTCGAGATGTTCTATCAACATGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146078.2-5253s1c1
Sequence:CCGGGACGAGGAAATCCTTTACATTCTCGAGAATGTAAAGGATTTCCTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146078.2-1982s1c1
Sequence:CCGGGCAGGTTTGCATGTATTGTTACTCGAGTAACAATACATGCAAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175322    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146078.2-5448s1c1
Sequence:CCGGCCAGAAAGACAACAGGAAATACTCGAGTATTTCCTGTTGTCTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146078.2-4265s1c1
Sequence:CCGGGCGTTACTTCCTGTGGTACAACTCGAGTTGTACCACAGGAAGTAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146078
VALIDATED
UBR2 MISSION shRNA Lentiviral Transduction Particles
ubiquitin protein ligase E3 component n-recognin 2
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215931    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146078.2-5945s1c1
Sequence:CCGGCTTTGAAAGCATTACTCAATTCTCGAGAATTGAGTAATGCTTTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146078.2-4012s1c1
Sequence:CCGGCCCATATTCTGATAGCATAAACTCGAGTTTATGCTATCAGAATATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217252    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146078.2-5822s1c1
Sequence:CCGGCCAGAGCAAAGCAAGTCAATTCTCGAGAATTGACTTGCTTTGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146078.2-1982s21c1
Sequence:CCGGGCAGGTTTGCATGTATTGTTACTCGAGTAACAATACATGCAAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146078.2-5253s21c1
Sequence:CCGGGACGAGGAAATCCTTTACATTCTCGAGAATGTAAAGGATTTCCTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146078.2-4265s21c1
Sequence:CCGGGCGTTACTTCCTGTGGTACAACTCGAGTTGTACCACAGGAAGTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293096    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146078.2-5448s21c1
Sequence:CCGGCCAGAAAGACAACAGGAAATACTCGAGTATTTCCTGTTGTCTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194615    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146078.2-3647s1c1
Sequence:CCGGGCCCATTGTTGGCAAAGGTATCTCGAGATACCTTTGCCAACAATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194475    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146078.2-908s1c1
Sequence:CCGGGCAACTACAGTTGATCGAGATCTCGAGATCTCGATCAACTGTAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194410    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146078.2-2060s1c1
Sequence:CCGGCCACCCATGTTGATAGAACATCTCGAGATGTTCTATCAACATGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146078.2-5253s1c1
Sequence:CCGGGACGAGGAAATCCTTTACATTCTCGAGAATGTAAAGGATTTCCTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146078.2-1982s1c1
Sequence:CCGGGCAGGTTTGCATGTATTGTTACTCGAGTAACAATACATGCAAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175322    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146078.2-5448s1c1
Sequence:CCGGCCAGAAAGACAACAGGAAATACTCGAGTATTTCCTGTTGTCTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146078.2-4265s1c1
Sequence:CCGGGCGTTACTTCCTGTGGTACAACTCGAGTTGTACCACAGGAAGTAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks