EMAIL THIS PAGE TO A FRIEND

UBR3

ubiquitin protein ligase E3 component n-recognin 3 (putative)

Synonyms: ZNF650
Gene ID:
Mouse(68795) ubiquitin protein ligase E3 component n-recognin 3
Rat(311115) ubiquitin protein ligase E3 component n-recognin 3
Zebrafish(553247) ubiquitin protein ligase E3 component n-recognin 3
Horse(100063165) ubiquitin protein ligase E3 component n-recognin 3 (putative)
dog(478789) ubiquitin protein ligase E3 component n-recognin 3 (putative)
cow(537932) ubiquitin protein ligase E3 component n-recognin 3 (putative)
sheep(101107938) ubiquitin protein ligase E3 component n-recognin 3 (putative)
naked mole-rat(101709562) ubiquitin protein ligase E3 component n-recognin 3 (putative)
domestic guinea pig(100735875) ubiquitin protein ligase E3 component n-recognin 3 (putative)
203 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177783 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177783 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177783 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_172070 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_172070 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_172070 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU034411 MISSION® esiRNA esiRNA human UBR3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_172070 Rosetta Predictions human pricing
NM_001134550 Rosetta Predictions rat pricing
NM_001081548 Rosetta Predictions mouse pricing
NM_177783 Rosetta Predictions mouse pricing
XM_990935 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172070 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163916 predicted 3689
2 SASI_Hs02_00367791 predicted 2281
3 SASI_Hs02_00367792 predicted 3368
4 SASI_Hs01_00163917 predicted 5580
5 SASI_Hs02_00367793 predicted 654
6 SASI_Hs02_00367794 predicted 2978
7 SASI_Hs02_00367795 predicted 1795
8 SASI_Hs01_00163920 predicted 4026
9 SASI_Hs01_00163922 predicted 4722
10 SASI_Hs02_00367796 predicted 2089
11 SASI_Hs01_00163918 predicted 1545
12 SASI_Hs01_00163919 predicted 1099
13 SASI_Hs01_00163921 predicted 2287
14 SASI_Hs01_00163923 predicted 1624
15 SASI_Hs01_00163924 predicted 298
16 SASI_Hs01_00163925 predicted 480
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134550 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256989 predicted 5143
2 SASI_Rn02_00256990 predicted 5114
3 SASI_Rn02_00256991 predicted 3657
4 SASI_Rn02_00256992 predicted 4142
5 SASI_Rn02_00256993 predicted 3465
6 SASI_Rn02_00256994 predicted 5129
7 SASI_Rn02_00256995 predicted 4702
8 SASI_Rn02_00256996 predicted 4386
9 SASI_Rn02_00256997 predicted 3955
10 SASI_Rn02_00256998 predicted 4631
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081548 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298650 predicted 2512
2 SASI_Mm02_00298651 predicted 3623
3 SASI_Mm02_00298652 predicted 2545
4 SASI_Mm02_00298653 predicted 2086
5 SASI_Mm02_00298654 predicted 1872
6 SASI_Mm02_00298655 predicted 3804
7 SASI_Mm02_00298656 predicted 3614
8 SASI_Mm02_00298657 predicted 2137
9 SASI_Mm02_00298658 predicted 3183
10 SASI_Mm02_00298659 predicted 3898
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177783 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348208 predicted 2510
2 SASI_Mm02_00348209 predicted 3623
3 SASI_Mm02_00348210 predicted 2546
4 SASI_Mm02_00348211 predicted 2087
5 SASI_Mm02_00348212 predicted 1871
6 SASI_Mm02_00348213 predicted 3812
7 SASI_Mm02_00348214 predicted 3619
8 SASI_Mm02_00348215 predicted 2137
9 SASI_Mm02_00348216 predicted 3181
10 SASI_Mm02_00348217 predicted 3907
11 SASI_Mm01_00030510 predicted 1308
12 SASI_Mm01_00030511 predicted 1180
13 SASI_Mm01_00030512 predicted 1563
14 SASI_Mm01_00030513 predicted 645
15 SASI_Mm01_00030514 predicted 1458
16 SASI_Mm01_00030515 predicted 1571
17 SASI_Mm01_00030516 predicted 1294
18 SASI_Mm01_00030517 predicted 1173
19 SASI_Mm01_00030518 predicted 865
20 SASI_Mm01_00030519 predicted 1298
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_990935 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00212385 predicted 2877
2 SASI_Mm01_00212386 predicted 2771
3 SASI_Mm01_00212387 predicted 2355
4 SASI_Mm01_00212388 predicted 2916
5 SASI_Mm01_00212389 predicted 2100
6 SASI_Mm01_00212390 predicted 1884
7 SASI_Mm01_00212391 predicted 1980
8 SASI_Mm01_00212392 predicted 2377
9 SASI_Mm01_00212393 predicted 1998
10 SASI_Mm01_00212394 predicted 2290
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177783
VALIDATED
UBR3 MISSION shRNA Bacterial Glycerol Stock
ubiquitin protein ligase E3 component n-recognin 3 (putative)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200625    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177783.2-1639s1c1
Sequence:CCGGCGCTAACACTTTGCTGTATTTCTCGAGAAATACAGCAAAGTGTTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177783.2-1472s1c1
Sequence:CCGGCCACTTGCTTACTATTAGTGACTCGAGTCACTAATAGTAAGCAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177783.2-806s1c1
Sequence:CCGGCCAGCAGAACTACAAAGACCTCTCGAGAGGTCTTTGTAGTTCTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177783.2-1614s1c1
Sequence:CCGGCCTAGTTTAGTCCTTCACAAACTCGAGTTTGTGAAGGACTAAACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177783.2-1087s1c1
Sequence:CCGGGCACCAAAGATCAATCCATAACTCGAGTTATGGATTGATCTTTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177783.5-924s21c1
Sequence:CCGGGTCACGAGAAGTACCTTATAGCTCGAGCTATAAGGTACTTCTCGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367247    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177783.5-5724s21c1
Sequence:CCGGCACCTCAGCATTGCATATATTCTCGAGAATATATGCAATGCTGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177783.5-2740s21c1
Sequence:CCGGCAATCCCTGGCCTCCGTATAACTCGAGTTATACGGAGGCCAGGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177783.5-707s21c1
Sequence:CCGGTACTTAAGAGAAGGCTATAATCTCGAGATTATAGCCTTCTCTTAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177783.5-3940s21c1
Sequence:CCGGTTCATTACTGCAGCGTTATTTCTCGAGAAATAACGCTGCAGTAATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177783
VALIDATED
UBR3 MISSION shRNA shRNA Plasmid DNA
ubiquitin protein ligase E3 component n-recognin 3 (putative)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200625    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177783.2-1639s1c1
Sequence:CCGGCGCTAACACTTTGCTGTATTTCTCGAGAAATACAGCAAAGTGTTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177783.2-1472s1c1
Sequence:CCGGCCACTTGCTTACTATTAGTGACTCGAGTCACTAATAGTAAGCAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177783.2-806s1c1
Sequence:CCGGCCAGCAGAACTACAAAGACCTCTCGAGAGGTCTTTGTAGTTCTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177783.2-1614s1c1
Sequence:CCGGCCTAGTTTAGTCCTTCACAAACTCGAGTTTGTGAAGGACTAAACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177783.2-1087s1c1
Sequence:CCGGGCACCAAAGATCAATCCATAACTCGAGTTATGGATTGATCTTTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177783.5-924s21c1
Sequence:CCGGGTCACGAGAAGTACCTTATAGCTCGAGCTATAAGGTACTTCTCGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367247    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177783.5-5724s21c1
Sequence:CCGGCACCTCAGCATTGCATATATTCTCGAGAATATATGCAATGCTGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177783.5-2740s21c1
Sequence:CCGGCAATCCCTGGCCTCCGTATAACTCGAGTTATACGGAGGCCAGGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177783.5-707s21c1
Sequence:CCGGTACTTAAGAGAAGGCTATAATCTCGAGATTATAGCCTTCTCTTAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177783.5-3940s21c1
Sequence:CCGGTTCATTACTGCAGCGTTATTTCTCGAGAAATAACGCTGCAGTAATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177783
VALIDATED
UBR3 MISSION shRNA Lentiviral Transduction Particles
ubiquitin protein ligase E3 component n-recognin 3 (putative)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200625    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177783.2-1639s1c1
Sequence:CCGGCGCTAACACTTTGCTGTATTTCTCGAGAAATACAGCAAAGTGTTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177783.2-1472s1c1
Sequence:CCGGCCACTTGCTTACTATTAGTGACTCGAGTCACTAATAGTAAGCAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177783.2-806s1c1
Sequence:CCGGCCAGCAGAACTACAAAGACCTCTCGAGAGGTCTTTGTAGTTCTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177783.2-1614s1c1
Sequence:CCGGCCTAGTTTAGTCCTTCACAAACTCGAGTTTGTGAAGGACTAAACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177783.2-1087s1c1
Sequence:CCGGGCACCAAAGATCAATCCATAACTCGAGTTATGGATTGATCTTTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177783.5-924s21c1
Sequence:CCGGGTCACGAGAAGTACCTTATAGCTCGAGCTATAAGGTACTTCTCGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367247    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177783.5-5724s21c1
Sequence:CCGGCACCTCAGCATTGCATATATTCTCGAGAATATATGCAATGCTGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177783.5-2740s21c1
Sequence:CCGGCAATCCCTGGCCTCCGTATAACTCGAGTTATACGGAGGCCAGGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177783.5-707s21c1
Sequence:CCGGTACTTAAGAGAAGGCTATAATCTCGAGATTATAGCCTTCTCTTAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177783.5-3940s21c1
Sequence:CCGGTTCATTACTGCAGCGTTATTTCTCGAGAAATAACGCTGCAGTAATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172070
UBR3 MISSION shRNA Bacterial Glycerol Stock
ubiquitin protein ligase E3 component n-recognin 3 (putative)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172070.2-423s1c1
Sequence:CCGGGCAGTATATGACTGTGTTATTCTCGAGAATAACACAGTCATATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172070.2-1378s1c1
Sequence:CCGGCCTTACGCAAAGACCACTTTACTCGAGTAAAGTGGTCTTTGCGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172070.2-1555s1c1
Sequence:CCGGGCTTTGTGATAAGTGAACTATCTCGAGATAGTTCACTTATCACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172070.2-2280s1c1
Sequence:CCGGCGAGGCAAACCTCTCTACATTCTCGAGAATGTAGAGAGGTTTGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172070.2-601s1c1
Sequence:CCGGCCGTTCATGATGTGAGGCTTTCTCGAGAAAGCCTCACATCATGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436376    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172070.3-6053s21c1
Sequence:CCGGTTGCATCTGCCAAGCATAATGCTCGAGCATTATGCTTGGCAGATGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172070.3-3112s21c1
Sequence:CCGGTTAGTAGCAGAACGTAGAAAGCTCGAGCTTTCTACGTTCTGCTACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172070.3-5681s21c1
Sequence:CCGGCATTGCATCGTATCATCATTTCTCGAGAAATGATGATACGATGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172070.3-4495s21c1
Sequence:CCGGAGCATTGACTCTGAGTATAATCTCGAGATTATACTCAGAGTCAATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172070.3-658s21c1
Sequence:CCGGTACTTAAGAGAAGGCTATAATCTCGAGATTATAGCCTTCTCTTAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172070.3-4617s21c1
Sequence:CCGGTTTGCTCATCCAGATCTTAATCTCGAGATTAAGATCTGGATGAGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172070.3-5450s21c1
Sequence:CCGATGATCAATGCATCGGTAATTACTCGAGTAATTACCGATGCATTGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172070
UBR3 MISSION shRNA shRNA Plasmid DNA
ubiquitin protein ligase E3 component n-recognin 3 (putative)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172070.2-423s1c1
Sequence:CCGGGCAGTATATGACTGTGTTATTCTCGAGAATAACACAGTCATATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172070.2-1378s1c1
Sequence:CCGGCCTTACGCAAAGACCACTTTACTCGAGTAAAGTGGTCTTTGCGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172070.2-1555s1c1
Sequence:CCGGGCTTTGTGATAAGTGAACTATCTCGAGATAGTTCACTTATCACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172070.2-2280s1c1
Sequence:CCGGCGAGGCAAACCTCTCTACATTCTCGAGAATGTAGAGAGGTTTGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172070.2-601s1c1
Sequence:CCGGCCGTTCATGATGTGAGGCTTTCTCGAGAAAGCCTCACATCATGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436376    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172070.3-6053s21c1
Sequence:CCGGTTGCATCTGCCAAGCATAATGCTCGAGCATTATGCTTGGCAGATGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172070.3-3112s21c1
Sequence:CCGGTTAGTAGCAGAACGTAGAAAGCTCGAGCTTTCTACGTTCTGCTACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172070.3-5681s21c1
Sequence:CCGGCATTGCATCGTATCATCATTTCTCGAGAAATGATGATACGATGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172070.3-4495s21c1
Sequence:CCGGAGCATTGACTCTGAGTATAATCTCGAGATTATACTCAGAGTCAATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172070.3-658s21c1
Sequence:CCGGTACTTAAGAGAAGGCTATAATCTCGAGATTATAGCCTTCTCTTAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172070.3-4617s21c1
Sequence:CCGGTTTGCTCATCCAGATCTTAATCTCGAGATTAAGATCTGGATGAGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172070.3-5450s21c1
Sequence:CCGATGATCAATGCATCGGTAATTACTCGAGTAATTACCGATGCATTGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172070
UBR3 MISSION shRNA Lentiviral Transduction Particles
ubiquitin protein ligase E3 component n-recognin 3 (putative)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172070.2-423s1c1
Sequence:CCGGGCAGTATATGACTGTGTTATTCTCGAGAATAACACAGTCATATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172070.2-1378s1c1
Sequence:CCGGCCTTACGCAAAGACCACTTTACTCGAGTAAAGTGGTCTTTGCGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172070.2-1555s1c1
Sequence:CCGGGCTTTGTGATAAGTGAACTATCTCGAGATAGTTCACTTATCACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172070.2-2280s1c1
Sequence:CCGGCGAGGCAAACCTCTCTACATTCTCGAGAATGTAGAGAGGTTTGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172070.2-601s1c1
Sequence:CCGGCCGTTCATGATGTGAGGCTTTCTCGAGAAAGCCTCACATCATGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436376    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172070.3-6053s21c1
Sequence:CCGGTTGCATCTGCCAAGCATAATGCTCGAGCATTATGCTTGGCAGATGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172070.3-3112s21c1
Sequence:CCGGTTAGTAGCAGAACGTAGAAAGCTCGAGCTTTCTACGTTCTGCTACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172070.3-5681s21c1
Sequence:CCGGCATTGCATCGTATCATCATTTCTCGAGAAATGATGATACGATGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172070.3-4495s21c1
Sequence:CCGGAGCATTGACTCTGAGTATAATCTCGAGATTATACTCAGAGTCAATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172070.3-658s21c1
Sequence:CCGGTACTTAAGAGAAGGCTATAATCTCGAGATTATAGCCTTCTCTTAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172070.3-4617s21c1
Sequence:CCGGTTTGCTCATCCAGATCTTAATCTCGAGATTAAGATCTGGATGAGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172070.3-5450s21c1
Sequence:CCGATGATCAATGCATCGGTAATTACTCGAGTAATTACCGATGCATTGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks