EMAIL THIS PAGE TO A FRIEND

UBR4

ubiquitin protein ligase E3 component n-recognin 4

Synonyms: RBAF600 ZUBR1 p600
Gene ID:
Human(23352) Summary: The protein encoded by this gene is an E3 ubiquitin-protein ligase that interacts with the retinoblastoma-associated protein in the nucleus and with calcium-bound calmodulin in the cytoplasm. The encoded protein appears to be a cytoskeletal component in the cytoplasm and part of the chromatin scaffold in the nucleus. In addition, this protein is a target of the human papillomavirus type 16 E7 oncoprotein. [provided by RefSeq, Aug 2010]
Mouse(69116) ubiquitin protein ligase E3 component n-recognin 4
Rat(313658) ubiquitin protein ligase E3 component n-recognin 4
domestic guinea pig(100725123) ubiquitin protein ligase E3 component n-recognin 4
naked mole-rat(101698740) ubiquitin protein ligase E3 component n-recognin 4
cow(514561) ubiquitin protein ligase E3 component n-recognin 4
sheep(101105396) ubiquitin protein ligase E3 component n-recognin 4
Zebrafish(407625) ubiquitin protein ligase E3 component n-recognin 4
dog(478211) ubiquitin protein ligase E3 component n-recognin 4
Horse(100071944) ubiquitin protein ligase E3 component n-recognin 4
domestic cat(101090277) ubiquitin protein ligase E3 component n-recognin 4
chicken(419469) ubiquitin protein ligase E3 component n-recognin 4
110 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001160319 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001160319 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001160319 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020765 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020765 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020765 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU044461 MISSION® esiRNA esiRNA human UBR4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020765 Rosetta Predictions human pricing
NM_001039026 Rosetta Predictions rat pricing
XM_001479450 Rosetta Predictions mouse pricing
XM_001479455 Rosetta Predictions mouse pricing
XM_001479738 Rosetta Predictions mouse pricing
XM_001479746 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020765 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018676 predicted 14819
2 SASI_Hs02_00353888 predicted 12039
3 SASI_Hs01_00018680 predicted 6043
4 SASI_Hs02_00353889 predicted 9460
5 SASI_Hs02_00353890 predicted 8240
6 SASI_Hs01_00018681 predicted 1701
7 SASI_Hs01_00018682 predicted 11710
8 SASI_Hs01_00018683 predicted 1928
9 SASI_Hs02_00353891 predicted 717
10 SASI_Hs02_00353892 predicted 3227
11 SASI_Hs01_00018674 predicted 1437
12 SASI_Hs01_00018675 predicted 12542
13 SASI_Hs01_00018677 predicted 3103
14 SASI_Hs01_00018678 predicted 5609
15 SASI_Hs01_00018679 predicted 840
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039026 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068257 predicted 15316
2 SASI_Rn01_00068258 predicted 4022
3 SASI_Rn01_00068259 predicted 4508
4 SASI_Rn01_00068260 predicted 9488
5 SASI_Rn01_00068261 predicted 3281
6 SASI_Rn01_00068262 predicted 12562
7 SASI_Rn01_00068263 predicted 7741
8 SASI_Rn02_00204773 predicted 2760
9 SASI_Rn01_00068266 predicted 2911
10 SASI_Rn02_00204774 predicted 14877
11 SASI_Rn01_00068264 predicted 5221
12 SASI_Rn01_00068265 predicted 13978
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001479450 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00410039 predicted 11853
2 SASI_Mm02_00410040 predicted 11068
3 SASI_Mm02_00410041 predicted 9851
4 SASI_Mm02_00410042 predicted 2301
5 SASI_Mm02_00410043 predicted 9413
6 SASI_Mm02_00410044 predicted 12510
7 SASI_Mm02_00410045 predicted 8000
8 SASI_Mm02_00410046 predicted 4498
9 SASI_Mm02_00410047 predicted 12056
10 SASI_Mm02_00410048 predicted 15418
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001479455 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00410079 predicted 11885
2 SASI_Mm02_00410080 predicted 11103
3 SASI_Mm02_00410081 predicted 9889
4 SASI_Mm02_00410082 predicted 2302
5 SASI_Mm02_00410083 predicted 9446
6 SASI_Mm02_00410084 predicted 12550
7 SASI_Mm02_00410085 predicted 7997
8 SASI_Mm02_00410086 predicted 4495
9 SASI_Mm02_00410087 predicted 12092
10 SASI_Mm02_00410088 predicted 15447
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001479738 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00412273 predicted 11845
2 SASI_Mm02_00412274 predicted 11062
3 SASI_Mm02_00412275 predicted 9855
4 SASI_Mm02_00412276 predicted 2303
5 SASI_Mm02_00412277 predicted 9413
6 SASI_Mm02_00412278 predicted 12518
7 SASI_Mm02_00412279 predicted 7994
8 SASI_Mm02_00412280 predicted 4498
9 SASI_Mm02_00412281 predicted 12051
10 SASI_Mm02_00412282 predicted 15414
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001479746 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00412326 predicted 11887
2 SASI_Mm02_00412327 predicted 11098
3 SASI_Mm02_00412328 predicted 9886
4 SASI_Mm02_00412329 predicted 2302
5 SASI_Mm02_00412330 predicted 9450
6 SASI_Mm02_00412331 predicted 12546
7 SASI_Mm02_00412332 predicted 7996
8 SASI_Mm02_00412333 predicted 4500
9 SASI_Mm02_00412334 predicted 12085
10 SASI_Mm02_00412335 predicted 15456
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001160319
VALIDATED
UBR4 MISSION shRNA Bacterial Glycerol Stock
ubiquitin protein ligase E3 component n-recognin 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001160319.1-13117s21c1
Sequence:CCGGGATGCCCGGAAACCCATATAGCTCGAGCTATATGGGTTTCCGGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001160319.1-1719s21c1
Sequence:CCGGCCGACTCCAACACGTACTATGCTCGAGCATAGTACGTGTTGGAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001160319.1-1880s21c1
Sequence:CCGGGAGAGCTCTCCTCGGGTTAAACTCGAGTTTAACCCGAGGAGAGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001160319.1-14566s21c1
Sequence:CCGGCACGAAGGTCTTAGGCATTTACTCGAGTAAATGCCTAAGACCTTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341872    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001160319.1-15623s21c1
Sequence:CCGGTCTCTCCGTGTGCACTCATTTCTCGAGAAATGAGTGCACACGGAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001160319
VALIDATED
UBR4 MISSION shRNA shRNA Plasmid DNA
ubiquitin protein ligase E3 component n-recognin 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001160319.1-13117s21c1
Sequence:CCGGGATGCCCGGAAACCCATATAGCTCGAGCTATATGGGTTTCCGGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001160319.1-1719s21c1
Sequence:CCGGCCGACTCCAACACGTACTATGCTCGAGCATAGTACGTGTTGGAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001160319.1-1880s21c1
Sequence:CCGGGAGAGCTCTCCTCGGGTTAAACTCGAGTTTAACCCGAGGAGAGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001160319.1-14566s21c1
Sequence:CCGGCACGAAGGTCTTAGGCATTTACTCGAGTAAATGCCTAAGACCTTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341872    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001160319.1-15623s21c1
Sequence:CCGGTCTCTCCGTGTGCACTCATTTCTCGAGAAATGAGTGCACACGGAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001160319
VALIDATED
UBR4 MISSION shRNA Lentiviral Transduction Particles
ubiquitin protein ligase E3 component n-recognin 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001160319.1-13117s21c1
Sequence:CCGGGATGCCCGGAAACCCATATAGCTCGAGCTATATGGGTTTCCGGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001160319.1-1719s21c1
Sequence:CCGGCCGACTCCAACACGTACTATGCTCGAGCATAGTACGTGTTGGAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001160319.1-1880s21c1
Sequence:CCGGGAGAGCTCTCCTCGGGTTAAACTCGAGTTTAACCCGAGGAGAGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001160319.1-14566s21c1
Sequence:CCGGCACGAAGGTCTTAGGCATTTACTCGAGTAAATGCCTAAGACCTTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341872    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001160319.1-15623s21c1
Sequence:CCGGTCTCTCCGTGTGCACTCATTTCTCGAGAAATGAGTGCACACGGAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020765
VALIDATED
UBR4 MISSION shRNA Bacterial Glycerol Stock
ubiquitin protein ligase E3 component n-recognin 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020765.1-210s1c1
Sequence:CCGGCGAGCCATTCTACTCATCTTTCTCGAGAAAGATGAGTAGAATGGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020765.1-880s1c1
Sequence:CCGGGCTGTTCGTAATGGCTTTCATCTCGAGATGAAAGCCATTACGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020765.1-8074s1c1
Sequence:CCGGGCTGTGAGCTTCTCTTGTAAACTCGAGTTTACAAGAGAAGCTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020765.1-10762s1c1
Sequence:CCGGCGGACCATCAACCTGTATTATCTCGAGATAATACAGGTTGATGGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020765.1-3040s1c1
Sequence:CCGGCCACCATCAAAGACTTACATTCTCGAGAATGTAAGTCTTTGATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020765.1-4487s1c1
Sequence:CCGGCCACATACATTGTTCGGGAAACTCGAGTTTCCCGAACAATGTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020765.1-6559s1c1
Sequence:CCGGCCGCTGGTAGTTATGGTGAAACTCGAGTTTCACCATAACTACCAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157658    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020765.1-13140s1c1
Sequence:CCGGGCCGCTGATGAGGGATATAAACTCGAGTTTATATCCCTCATCAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020765
VALIDATED
UBR4 MISSION shRNA shRNA Plasmid DNA
ubiquitin protein ligase E3 component n-recognin 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020765.1-210s1c1
Sequence:CCGGCGAGCCATTCTACTCATCTTTCTCGAGAAAGATGAGTAGAATGGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020765.1-880s1c1
Sequence:CCGGGCTGTTCGTAATGGCTTTCATCTCGAGATGAAAGCCATTACGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020765.1-8074s1c1
Sequence:CCGGGCTGTGAGCTTCTCTTGTAAACTCGAGTTTACAAGAGAAGCTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020765.1-10762s1c1
Sequence:CCGGCGGACCATCAACCTGTATTATCTCGAGATAATACAGGTTGATGGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020765.1-3040s1c1
Sequence:CCGGCCACCATCAAAGACTTACATTCTCGAGAATGTAAGTCTTTGATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020765.1-4487s1c1
Sequence:CCGGCCACATACATTGTTCGGGAAACTCGAGTTTCCCGAACAATGTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020765.1-6559s1c1
Sequence:CCGGCCGCTGGTAGTTATGGTGAAACTCGAGTTTCACCATAACTACCAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157658    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020765.1-13140s1c1
Sequence:CCGGGCCGCTGATGAGGGATATAAACTCGAGTTTATATCCCTCATCAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020765
VALIDATED
UBR4 MISSION shRNA Lentiviral Transduction Particles
ubiquitin protein ligase E3 component n-recognin 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020765.1-210s1c1
Sequence:CCGGCGAGCCATTCTACTCATCTTTCTCGAGAAAGATGAGTAGAATGGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020765.1-880s1c1
Sequence:CCGGGCTGTTCGTAATGGCTTTCATCTCGAGATGAAAGCCATTACGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020765.1-8074s1c1
Sequence:CCGGGCTGTGAGCTTCTCTTGTAAACTCGAGTTTACAAGAGAAGCTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020765.1-10762s1c1
Sequence:CCGGCGGACCATCAACCTGTATTATCTCGAGATAATACAGGTTGATGGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020765.1-3040s1c1
Sequence:CCGGCCACCATCAAAGACTTACATTCTCGAGAATGTAAGTCTTTGATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020765.1-4487s1c1
Sequence:CCGGCCACATACATTGTTCGGGAAACTCGAGTTTCCCGAACAATGTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020765.1-6559s1c1
Sequence:CCGGCCGCTGGTAGTTATGGTGAAACTCGAGTTTCACCATAACTACCAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157658    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020765.1-13140s1c1
Sequence:CCGGGCCGCTGATGAGGGATATAAACTCGAGTTTATATCCCTCATCAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks