EMAIL THIS PAGE TO A FRIEND

UBR5

ubiquitin protein ligase E3 component n-recognin 5

Synonyms: DD5 EDD EDD1 HYD
UniProtKB ID: O95071, B2RP24, O94970, Q9NPL3
Gene ID:
Human(51366) Summary: This gene encodes a progestin-induced protein, which belongs to the HECT (homology to E6-AP carboxyl terminus) family. The HECT family proteins function as E3 ubiquitin-protein ligases, targeting specific proteins for ubiquitin-mediated proteolysis. This gene is localized to chromosome 8q22 which is disrupted in a variety of cancers. This gene potentially has a role in regulation of cell proliferation or differentiation. [provided by RefSeq, Jul 2008]
Mouse(70790) ubiquitin protein ligase E3 component n-recognin 5
Rat(117060) ubiquitin protein ligase E3 component n-recognin 5
Zebrafish(334627) ubiquitin protein ligase E3 component n-recognin 5
chicken(420252) ubiquitin protein ligase E3 component n-recognin 5
domestic cat(101083741) ubiquitin protein ligase E3 component n-recognin 5
dog(475055) ubiquitin protein ligase E3 component n-recognin 5
cow(515582) ubiquitin protein ligase E3 component n-recognin 5
sheep(101104323) ubiquitin protein ligase E3 component n-recognin 5
naked mole-rat(101719374) ubiquitin protein ligase E3 component n-recognin 5
domestic guinea pig(100720846) ubiquitin protein ligase E3 component n-recognin 5
249 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015902 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015902 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015902 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081359 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081359 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081359 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015902 Rosetta Predictions human pricing
XM_001061308 Rosetta Predictions rat pricing
XM_576252 Rosetta Predictions rat pricing
NM_001081359 Rosetta Predictions mouse pricing
NM_001112721 Rosetta Predictions mouse pricing
XM_196130 Rosetta Predictions mouse pricing
XM_898859 Rosetta Predictions mouse pricing
XM_898862 Rosetta Predictions mouse pricing
XM_898865 Rosetta Predictions mouse pricing
XM_898869 Rosetta Predictions mouse pricing
XM_898872 Rosetta Predictions mouse pricing
XM_898875 Rosetta Predictions mouse pricing
XM_898880 Rosetta Predictions mouse pricing
XM_898886 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015902 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175227 predicted 4517
2 SASI_Hs02_00348492 predicted 559
3 SASI_Hs01_00175228 predicted 5376
4 SASI_Hs02_00348493 predicted 6756
5 SASI_Hs01_00175229 predicted 253
6 SASI_Hs02_00348494 predicted 6110
7 SASI_Hs01_00175231 predicted 735
8 SASI_Hs01_00175232 predicted 2951
9 SASI_Hs01_00175234 predicted 3807
10 SASI_Hs02_00348495 predicted 2683
11 SASI_Hs01_00175226 predicted 6800
12 SASI_Hs01_00175230 predicted 1716
13 SASI_Hs01_00175233 predicted 7846
14 SASI_Hs01_00175235 predicted 3388
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061308 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00299573 predicted 1658
2 SASI_Rn02_00299574 predicted 4559
3 SASI_Rn02_00299575 predicted 5030
4 SASI_Rn02_00299576 predicted 3555
5 SASI_Rn02_00299577 predicted 6685
6 SASI_Rn02_00299578 predicted 7556
7 SASI_Rn02_00299579 predicted 5431
8 SASI_Rn02_00299580 predicted 2886
9 SASI_Rn02_00299581 predicted 571
10 SASI_Rn02_00299582 predicted 2872
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576252 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404947 predicted 1655
2 SASI_Rn02_00404948 predicted 4556
3 SASI_Rn02_00404949 predicted 5037
4 SASI_Rn02_00404950 predicted 3551
5 SASI_Rn02_00404951 predicted 6682
6 SASI_Rn02_00404952 predicted 7555
7 SASI_Rn02_00404953 predicted 5424
8 SASI_Rn02_00404954 predicted 2888
9 SASI_Rn02_00404955 predicted 564
10 SASI_Rn02_00404956 predicted 2879
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081359 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297641 predicted 2129
2 SASI_Mm02_00297642 predicted 5506
3 SASI_Mm02_00297643 predicted 8032
4 SASI_Mm02_00297644 predicted 4019
5 SASI_Mm02_00297645 predicted 5893
6 SASI_Mm02_00297646 predicted 3344
7 SASI_Mm02_00297647 predicted 4301
8 SASI_Mm02_00297648 predicted 2775
9 SASI_Mm02_00297649 predicted 5028
10 SASI_Mm02_00297650 predicted 1019
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001112721 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307003 predicted 2111
2 SASI_Mm02_00307004 predicted 5486
3 SASI_Mm02_00307005 predicted 8008
4 SASI_Mm02_00307006 predicted 3998
5 SASI_Mm02_00307007 predicted 5881
6 SASI_Mm02_00307008 predicted 3325
7 SASI_Mm02_00307009 predicted 4280
8 SASI_Mm02_00307010 predicted 2759
9 SASI_Mm02_00307011 predicted 5012
10 SASI_Mm02_00307012 predicted 1015
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_196130 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00267567 predicted 8286
2 SASI_Mm01_00267568 predicted 8449
3 SASI_Mm01_00267569 predicted 8379
4 SASI_Mm01_00267570 predicted 8547
5 SASI_Mm01_00267571 predicted 8542
6 SASI_Mm01_00267572 predicted 8210
7 SASI_Mm01_00267573 predicted 8593
8 SASI_Mm01_00267574 predicted 8534
9 SASI_Mm01_00267575 predicted 8375
10 SASI_Mm01_00267576 predicted 8318
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898859 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00230633 predicted 2223
2 SASI_Mm01_00230634 predicted 2387
3 SASI_Mm01_00230635 predicted 2306
4 SASI_Mm01_00230636 predicted 2474
5 SASI_Mm01_00230637 predicted 2478
6 SASI_Mm01_00230638 predicted 2142
7 SASI_Mm01_00230639 predicted 2530
8 SASI_Mm01_00230640 predicted 2458
9 SASI_Mm01_00230641 predicted 2311
10 SASI_Mm01_00230642 predicted 2242
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898862 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00242709 predicted 3215
2 SASI_Mm01_00242710 predicted 3137
3 SASI_Mm01_00242711 predicted 3305
4 SASI_Mm01_00242712 predicted 3353
5 SASI_Mm01_00242713 predicted 3356
6 SASI_Mm01_00242714 predicted 3141
7 SASI_Mm01_00242715 predicted 3078
8 SASI_Mm01_00242716 predicted 3189
9 SASI_Mm01_00242717 predicted 3245
10 SASI_Mm01_00242718 predicted 3281
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898865 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00219701 predicted 1814
2 SASI_Mm01_00219702 predicted 1980
3 SASI_Mm01_00219703 predicted 1905
4 SASI_Mm01_00219704 predicted 2067
5 SASI_Mm01_00219705 predicted 2079
6 SASI_Mm01_00219706 predicted 1743
7 SASI_Mm01_00219707 predicted 2123
8 SASI_Mm01_00219708 predicted 2056
9 SASI_Mm01_00219709 predicted 1913
10 SASI_Mm01_00219710 predicted 1843
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898869 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00231060 predicted 8306
2 SASI_Mm01_00231061 predicted 8478
3 SASI_Mm01_00231062 predicted 8392
4 SASI_Mm01_00231063 predicted 8568
5 SASI_Mm01_00231064 predicted 8570
6 SASI_Mm01_00231065 predicted 8237
7 SASI_Mm01_00231066 predicted 8613
8 SASI_Mm01_00231067 predicted 8549
9 SASI_Mm01_00231068 predicted 8397
10 SASI_Mm01_00231069 predicted 8333
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898872 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00219944 predicted 1329
2 SASI_Mm01_00219945 predicted 1491
3 SASI_Mm01_00219946 predicted 1415
4 SASI_Mm01_00219947 predicted 1583
5 SASI_Mm01_00219948 predicted 1587
6 SASI_Mm01_00219949 predicted 1257
7 SASI_Mm01_00219950 predicted 1630
8 SASI_Mm01_00219951 predicted 1572
9 SASI_Mm01_00219952 predicted 1413
10 SASI_Mm01_00219953 predicted 1350
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898875 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00230953 predicted 2031
2 SASI_Mm01_00230954 predicted 2202
3 SASI_Mm01_00230955 predicted 2125
4 SASI_Mm01_00230956 predicted 2286
5 SASI_Mm01_00230957 predicted 2292
6 SASI_Mm01_00230958 predicted 1965
7 SASI_Mm01_00230959 predicted 2337
8 SASI_Mm01_00230960 predicted 2283
9 SASI_Mm01_00230961 predicted 2127
10 SASI_Mm01_00230962 predicted 2065
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898880 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00234127 predicted 5061
2 SASI_Mm01_00234128 predicted 5222
3 SASI_Mm01_00234129 predicted 5151
4 SASI_Mm01_00234130 predicted 5313
5 SASI_Mm01_00234131 predicted 5318
6 SASI_Mm01_00234132 predicted 4987
7 SASI_Mm01_00234133 predicted 5373
8 SASI_Mm01_00234134 predicted 5308
9 SASI_Mm01_00234135 predicted 5148
10 SASI_Mm01_00234136 predicted 5088
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898886 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00252122 predicted 5012
2 SASI_Mm01_00252123 predicted 5174
3 SASI_Mm01_00252124 predicted 5091
4 SASI_Mm01_00252125 predicted 5263
5 SASI_Mm01_00252126 predicted 5263
6 SASI_Mm01_00252127 predicted 4932
7 SASI_Mm01_00252128 predicted 5315
8 SASI_Mm01_00252129 predicted 5255
9 SASI_Mm01_00252130 predicted 5101
10 SASI_Mm01_00252131 predicted 5041
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015902
VALIDATED
UBR5 MISSION shRNA Bacterial Glycerol Stock
ubiquitin protein ligase E3 component n-recognin 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003409    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015902.x-8678s1c1
Sequence:CCGGTGACAGCAGAACAACATAATTCTCGAGAATTATGTTGTTCTGCTGTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015902.x-1745s1c1
Sequence:CCGGGCTGTAGATTTCAACTTAGATCTCGAGATCTAAGTTGAAATCTACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015902.x-5112s1c1
Sequence:CCGGGCCATTAGAAAGAACCACAAACTCGAGTTTGTGGTTCTTTCTAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_015902.x-3781s1c1
Sequence:CCGGGCTCGTCTTGATCTACTTTATCTCGAGATAAAGTAGATCAAGACGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015902.x-1230s1c1
Sequence:CCGGGCCTTACAGAAATGCCCAGAACTCGAGTTCTGGGCATTTCTGTAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015902.4-160s21c1
Sequence:CCGGTTGGAACAGGCTACTATTAAACTCGAGTTTAATAGTAGCCTGTTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015902.4-8992s21c1
Sequence:CCGGCATTGAGCTCTAGGATATTAACTCGAGTTAATATCCTAGAGCTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218934    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015902.4-8609s21c1
Sequence:GTACCGGTAGCAACATTTGGCTATATTGCTCGAGCAATATAGCCAAATGTTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226461    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015902.4-9169s21c1
Sequence:CCGGTTCAGTTCTAACTAGACATTTCTCGAGAAATGTCTAGTTAGAACTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226459    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015902.4-8574s21c1
Sequence:CCGGTTGCTGAGTTTATAGCTTAAACTCGAGTTTAAGCTATAAACTCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015902
VALIDATED
UBR5 MISSION shRNA shRNA Plasmid DNA
ubiquitin protein ligase E3 component n-recognin 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003409    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015902.x-8678s1c1
Sequence:CCGGTGACAGCAGAACAACATAATTCTCGAGAATTATGTTGTTCTGCTGTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015902.x-1745s1c1
Sequence:CCGGGCTGTAGATTTCAACTTAGATCTCGAGATCTAAGTTGAAATCTACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015902.x-5112s1c1
Sequence:CCGGGCCATTAGAAAGAACCACAAACTCGAGTTTGTGGTTCTTTCTAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_015902.x-3781s1c1
Sequence:CCGGGCTCGTCTTGATCTACTTTATCTCGAGATAAAGTAGATCAAGACGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015902.x-1230s1c1
Sequence:CCGGGCCTTACAGAAATGCCCAGAACTCGAGTTCTGGGCATTTCTGTAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015902.4-160s21c1
Sequence:CCGGTTGGAACAGGCTACTATTAAACTCGAGTTTAATAGTAGCCTGTTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015902.4-8992s21c1
Sequence:CCGGCATTGAGCTCTAGGATATTAACTCGAGTTAATATCCTAGAGCTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218934    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015902.4-8609s21c1
Sequence:GTACCGGTAGCAACATTTGGCTATATTGCTCGAGCAATATAGCCAAATGTTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226461    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015902.4-9169s21c1
Sequence:CCGGTTCAGTTCTAACTAGACATTTCTCGAGAAATGTCTAGTTAGAACTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226459    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015902.4-8574s21c1
Sequence:CCGGTTGCTGAGTTTATAGCTTAAACTCGAGTTTAAGCTATAAACTCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015902
VALIDATED
UBR5 MISSION shRNA Lentiviral Transduction Particles
ubiquitin protein ligase E3 component n-recognin 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003409    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015902.x-8678s1c1
Sequence:CCGGTGACAGCAGAACAACATAATTCTCGAGAATTATGTTGTTCTGCTGTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015902.x-1745s1c1
Sequence:CCGGGCTGTAGATTTCAACTTAGATCTCGAGATCTAAGTTGAAATCTACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015902.x-5112s1c1
Sequence:CCGGGCCATTAGAAAGAACCACAAACTCGAGTTTGTGGTTCTTTCTAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_015902.x-3781s1c1
Sequence:CCGGGCTCGTCTTGATCTACTTTATCTCGAGATAAAGTAGATCAAGACGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015902.x-1230s1c1
Sequence:CCGGGCCTTACAGAAATGCCCAGAACTCGAGTTCTGGGCATTTCTGTAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015902.4-160s21c1
Sequence:CCGGTTGGAACAGGCTACTATTAAACTCGAGTTTAATAGTAGCCTGTTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015902.4-8992s21c1
Sequence:CCGGCATTGAGCTCTAGGATATTAACTCGAGTTAATATCCTAGAGCTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218934    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015902.4-8609s21c1
Sequence:GTACCGGTAGCAACATTTGGCTATATTGCTCGAGCAATATAGCCAAATGTTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226461    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015902.4-9169s21c1
Sequence:CCGGTTCAGTTCTAACTAGACATTTCTCGAGAAATGTCTAGTTAGAACTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226459    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015902.4-8574s21c1
Sequence:CCGGTTGCTGAGTTTATAGCTTAAACTCGAGTTTAAGCTATAAACTCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081359
VALIDATED
UBR5 MISSION shRNA Bacterial Glycerol Stock
ubiquitin protein ligase E3 component n-recognin 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238587    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081359.2-9405s21c1
Sequence:CCGGATTGAGCTCTAGGATACTAAACTCGAGTTTAGTATCCTAGAGCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081359.2-4594s21c1
Sequence:CCGGTCAAGTGTACAGCAGATATTTCTCGAGAAATATCTGCTGTACACTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081359.2-554s21c1
Sequence:CCGGACTGGAGCAGGCTACTATTAACTCGAGTTAATAGTAGCCTGCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081359.2-8723s21c1
Sequence:CCGGTACTTGTATTTCTCGACTTTACTCGAGTAAAGTCGAGAAATACAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081359.2-6285s21c1
Sequence:CCGGGCCCTTATATACTGGATTAAACTCGAGTTTAATCCAGTATATAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081359
VALIDATED
UBR5 MISSION shRNA shRNA Plasmid DNA
ubiquitin protein ligase E3 component n-recognin 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238587    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081359.2-9405s21c1
Sequence:CCGGATTGAGCTCTAGGATACTAAACTCGAGTTTAGTATCCTAGAGCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081359.2-4594s21c1
Sequence:CCGGTCAAGTGTACAGCAGATATTTCTCGAGAAATATCTGCTGTACACTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081359.2-554s21c1
Sequence:CCGGACTGGAGCAGGCTACTATTAACTCGAGTTAATAGTAGCCTGCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081359.2-8723s21c1
Sequence:CCGGTACTTGTATTTCTCGACTTTACTCGAGTAAAGTCGAGAAATACAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081359.2-6285s21c1
Sequence:CCGGGCCCTTATATACTGGATTAAACTCGAGTTTAATCCAGTATATAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081359
VALIDATED
UBR5 MISSION shRNA Lentiviral Transduction Particles
ubiquitin protein ligase E3 component n-recognin 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238587    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081359.2-9405s21c1
Sequence:CCGGATTGAGCTCTAGGATACTAAACTCGAGTTTAGTATCCTAGAGCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081359.2-4594s21c1
Sequence:CCGGTCAAGTGTACAGCAGATATTTCTCGAGAAATATCTGCTGTACACTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081359.2-554s21c1
Sequence:CCGGACTGGAGCAGGCTACTATTAACTCGAGTTAATAGTAGCCTGCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081359.2-8723s21c1
Sequence:CCGGTACTTGTATTTCTCGACTTTACTCGAGTAAAGTCGAGAAATACAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081359.2-6285s21c1
Sequence:CCGGGCCCTTATATACTGGATTAAACTCGAGTTTAATCCAGTATATAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks