EMAIL THIS PAGE TO A FRIEND

UBR7

ubiquitin protein ligase E3 component n-recognin 7 (putative)

Synonyms: C14orf130
UniProtKB ID: Q8N806, Q86U21, Q86UA9, Q96BY0, Q9NVV6
Gene ID:
Mouse(66622) ubiquitin protein ligase E3 component n-recognin 7 (putative)
Rat(314399) ubiquitin protein ligase E3 component n-recognin 7 (putative)
domestic guinea pig(100717054) ubiquitin protein ligase E3 component n-recognin 7 (putative)
naked mole-rat(101702354) ubiquitin protein ligase E3 component n-recognin 7 (putative)
cow(505130) ubiquitin protein ligase E3 component n-recognin 7 (putative)
sheep(101113015) ubiquitin protein ligase E3 component n-recognin 7 (putative)
Zebrafish(322815) ubiquitin protein ligase E3 component n-recognin 7
chicken(772299) ubiquitin protein ligase E3 component n-recognin 7 (putative)
dog(480419) ubiquitin protein ligase E3 component n-recognin 7 (putative)
domestic cat(101099472) ubiquitin protein ligase E3 component n-recognin 7 (putative)
Horse(100064025) ubiquitin protein ligase E3 component n-recognin 7 (putative)
95 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV43242 Anti-C14ORF130 (AB1) antibody produced in rabbit IgG fraction of antiserum bovine, human, rabbit, rat, horse, canine, mouse, guinea pig
immunohistochemistry, western blot pricing
AV43243 Anti-C14ORF130 (AB2) antibody produced in rabbit IgG fraction of antiserum human, bovine, rat, rabbit, zebrafish, horse, guinea pig, mouse, canine
immunohistochemistry, western blot pricing
SAB2103190 Anti-C14ORF130, (N-terminal) antibody produced in rabbit affinity isolated antibody bovine, human, rabbit, canine, mouse, rat, horse, zebrafish, guinea pig
western blot pricing
SAB1305273 ANTI-UBR7 (N-TERM) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
HPA000861 Anti-UBR7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025666 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025666 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025666 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_175748 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175748 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175748 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018108 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018108 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018108 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100417 Rosetta Predictions human pricing
NM_018108 Rosetta Predictions human pricing
NM_175748 Rosetta Predictions human pricing
NM_001007705 Rosetta Predictions rat pricing
NM_025666 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100417 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322004 predicted 1103
2 SASI_Hs02_00322005 predicted 1397
3 SASI_Hs02_00322006 predicted 1233
4 SASI_Hs02_00322007 predicted 1208
5 SASI_Hs02_00322008 predicted 1066
6 SASI_Hs02_00322009 predicted 1362
7 SASI_Hs02_00322010 predicted 685
8 SASI_Hs02_00322011 predicted 846
9 SASI_Hs02_00322012 predicted 920
10 SASI_Hs02_00322013 predicted 1266
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018108 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212770 predicted 1329
2 SASI_Hs01_00212771 predicted 698
3 SASI_Hs01_00212772 predicted 1001
4 SASI_Hs01_00212773 predicted 1292
5 SASI_Hs01_00212774 predicted 624
6 SASI_Hs01_00212775 predicted 854
7 SASI_Hs01_00212776 predicted 1206
8 SASI_Hs01_00212777 predicted 914
9 SASI_Hs01_00212778 predicted 904
10 SASI_Hs01_00212779 predicted 1007
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175748 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369103 predicted 1238
2 SASI_Hs02_00369104 predicted 1523
3 SASI_Hs02_00369105 predicted 1370
4 SASI_Hs02_00369106 predicted 1344
5 SASI_Hs01_00113622 predicted 1203
6 SASI_Hs02_00369107 predicted 1490
7 SASI_Hs01_00113623 predicted 817
8 SASI_Hs02_00369108 predicted 983
9 SASI_Hs01_00113624 predicted 1055
10 SASI_Hs02_00369109 predicted 1404
11 SASI_Hs01_00113617 predicted 439
12 SASI_Hs01_00113618 predicted 388
13 SASI_Hs01_00113619 predicted 880
14 SASI_Hs01_00113620 predicted 473
15 SASI_Hs01_00113621 predicted 425
16 SASI_Hs01_00113625 predicted 593
17 SASI_Hs01_00113626 predicted 1095
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007705 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063666 predicted 769
2 SASI_Rn01_00063667 predicted 1352
3 SASI_Rn01_00063668 predicted 573
4 SASI_Rn01_00063669 predicted 439
5 SASI_Rn01_00063670 predicted 351
6 SASI_Rn01_00063671 predicted 416
7 SASI_Rn01_00063673 predicted 1045
8 SASI_Rn01_00063674 predicted 473
9 SASI_Rn01_00063675 predicted 241
10 SASI_Rn02_00198879 predicted 1338
11 SASI_Rn01_00063672 predicted 327
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025666 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136143 predicted 1068
2 SASI_Mm01_00136144 predicted 264
3 SASI_Mm01_00136146 predicted 305
4 SASI_Mm01_00136147 predicted 384
5 SASI_Mm01_00136148 predicted 598
6 SASI_Mm01_00136149 predicted 504
7 SASI_Mm01_00136150 predicted 1113
8 SASI_Mm01_00136151 predicted 446
9 SASI_Mm02_00328802 predicted 717
10 SASI_Mm01_00136152 predicted 344
11 SASI_Mm01_00136145 predicted 972
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025666
VALIDATED
UBR7 MISSION shRNA Bacterial Glycerol Stock
ubiquitin protein ligase E3 component n-recognin 7 (putative)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025666.2-295s21c1
Sequence:CCGGGAATGTCATGGAAGCCATAAACTCGAGTTTATGGCTTCCATGACATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025666.2-655s21c1
Sequence:CCGGGTCACCAGGATATCTGCTGAACTCGAGTTCAGCAGATATCCTGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025666.2-283s21c1
Sequence:CCGGGCTTGCAGTTACGAATGTCATCTCGAGATGACATTCGTAACTGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217236    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025666.2-927s1c1
Sequence:CCGGCCAAGCCAAGCAGTTTGTAAACTCGAGTTTACAAACTGCTTGGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217433    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025666.2-458s1c1
Sequence:CCGGGCGTTTGTAAGAGACCTTATCCTCGAGGATAAGGTCTCTTACAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025666.2-1252s21c1
Sequence:CCGGGAAGACATTCAGCAGTTCTTTCTCGAGAAAGAACTGCTGAATGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025666.1-657s1c1
Sequence:CCGGGTCACCAGGATATCTGCTGAACTCGAGTTCAGCAGATATCCTGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025666.1-1254s1c1
Sequence:CCGGGAAGACATTCAGCAGTTCTTTCTCGAGAAAGAACTGCTGAATGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025666.1-285s1c1
Sequence:CCGGGCTTGCAGTTACGAATGTCATCTCGAGATGACATTCGTAACTGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025666.1-297s1c1
Sequence:CCGGGAATGTCATGGAAGCCATAAACTCGAGTTTATGGCTTCCATGACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025666.1-1175s1c1
Sequence:CCGGCTGTGAATACAATGACTTGAACTCGAGTTCAAGTCATTGTATTCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025666
VALIDATED
UBR7 MISSION shRNA shRNA Plasmid DNA
ubiquitin protein ligase E3 component n-recognin 7 (putative)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025666.2-295s21c1
Sequence:CCGGGAATGTCATGGAAGCCATAAACTCGAGTTTATGGCTTCCATGACATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025666.2-655s21c1
Sequence:CCGGGTCACCAGGATATCTGCTGAACTCGAGTTCAGCAGATATCCTGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025666.2-283s21c1
Sequence:CCGGGCTTGCAGTTACGAATGTCATCTCGAGATGACATTCGTAACTGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217236    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025666.2-927s1c1
Sequence:CCGGCCAAGCCAAGCAGTTTGTAAACTCGAGTTTACAAACTGCTTGGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217433    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025666.2-458s1c1
Sequence:CCGGGCGTTTGTAAGAGACCTTATCCTCGAGGATAAGGTCTCTTACAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025666.2-1252s21c1
Sequence:CCGGGAAGACATTCAGCAGTTCTTTCTCGAGAAAGAACTGCTGAATGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025666.1-657s1c1
Sequence:CCGGGTCACCAGGATATCTGCTGAACTCGAGTTCAGCAGATATCCTGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025666.1-1254s1c1
Sequence:CCGGGAAGACATTCAGCAGTTCTTTCTCGAGAAAGAACTGCTGAATGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025666.1-285s1c1
Sequence:CCGGGCTTGCAGTTACGAATGTCATCTCGAGATGACATTCGTAACTGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025666.1-297s1c1
Sequence:CCGGGAATGTCATGGAAGCCATAAACTCGAGTTTATGGCTTCCATGACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025666.1-1175s1c1
Sequence:CCGGCTGTGAATACAATGACTTGAACTCGAGTTCAAGTCATTGTATTCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025666
VALIDATED
UBR7 MISSION shRNA Lentiviral Transduction Particles
ubiquitin protein ligase E3 component n-recognin 7 (putative)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025666.2-295s21c1
Sequence:CCGGGAATGTCATGGAAGCCATAAACTCGAGTTTATGGCTTCCATGACATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025666.2-655s21c1
Sequence:CCGGGTCACCAGGATATCTGCTGAACTCGAGTTCAGCAGATATCCTGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025666.2-283s21c1
Sequence:CCGGGCTTGCAGTTACGAATGTCATCTCGAGATGACATTCGTAACTGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217236    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025666.2-927s1c1
Sequence:CCGGCCAAGCCAAGCAGTTTGTAAACTCGAGTTTACAAACTGCTTGGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217433    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025666.2-458s1c1
Sequence:CCGGGCGTTTGTAAGAGACCTTATCCTCGAGGATAAGGTCTCTTACAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025666.2-1252s21c1
Sequence:CCGGGAAGACATTCAGCAGTTCTTTCTCGAGAAAGAACTGCTGAATGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025666.1-657s1c1
Sequence:CCGGGTCACCAGGATATCTGCTGAACTCGAGTTCAGCAGATATCCTGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025666.1-1254s1c1
Sequence:CCGGGAAGACATTCAGCAGTTCTTTCTCGAGAAAGAACTGCTGAATGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025666.1-285s1c1
Sequence:CCGGGCTTGCAGTTACGAATGTCATCTCGAGATGACATTCGTAACTGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025666.1-297s1c1
Sequence:CCGGGAATGTCATGGAAGCCATAAACTCGAGTTTATGGCTTCCATGACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025666.1-1175s1c1
Sequence:CCGGCTGTGAATACAATGACTTGAACTCGAGTTCAAGTCATTGTATTCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175748
VALIDATED
UBR7 MISSION shRNA Bacterial Glycerol Stock
ubiquitin protein ligase E3 component n-recognin 7 (putative)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000286940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_175748.3-787s21c1
Sequence:CCGGCCTGCATGAAACGTTGTTCTTCTCGAGAAGAACAACGTTTCATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_175748.3-1106s21c1
Sequence:CCGGGCTTAAAGCTAAGCAGCTTATCTCGAGATAAGCTGCTTAGCTTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_175748.3-972s21c1
Sequence:CCGGGATGATGTCCGGGAGGTTAAACTCGAGTTTAACCTCCCGGACATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307300    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_175748.3-1755s21c1
Sequence:CCGGCAGTGCACCCAGGGTTATTTGCTCGAGCAAATAACCCTGGGTGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_175748.3-1090s21c1
Sequence:CCGGGCTGCAAACTTCAGGAGCTTACTCGAGTAAGCTCCTGAAGTTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175748
VALIDATED
UBR7 MISSION shRNA shRNA Plasmid DNA
ubiquitin protein ligase E3 component n-recognin 7 (putative)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000286940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_175748.3-787s21c1
Sequence:CCGGCCTGCATGAAACGTTGTTCTTCTCGAGAAGAACAACGTTTCATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_175748.3-1106s21c1
Sequence:CCGGGCTTAAAGCTAAGCAGCTTATCTCGAGATAAGCTGCTTAGCTTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_175748.3-972s21c1
Sequence:CCGGGATGATGTCCGGGAGGTTAAACTCGAGTTTAACCTCCCGGACATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307300    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_175748.3-1755s21c1
Sequence:CCGGCAGTGCACCCAGGGTTATTTGCTCGAGCAAATAACCCTGGGTGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_175748.3-1090s21c1
Sequence:CCGGGCTGCAAACTTCAGGAGCTTACTCGAGTAAGCTCCTGAAGTTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175748
VALIDATED
UBR7 MISSION shRNA Lentiviral Transduction Particles
ubiquitin protein ligase E3 component n-recognin 7 (putative)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000286940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_175748.3-787s21c1
Sequence:CCGGCCTGCATGAAACGTTGTTCTTCTCGAGAAGAACAACGTTTCATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_175748.3-1106s21c1
Sequence:CCGGGCTTAAAGCTAAGCAGCTTATCTCGAGATAAGCTGCTTAGCTTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_175748.3-972s21c1
Sequence:CCGGGATGATGTCCGGGAGGTTAAACTCGAGTTTAACCTCCCGGACATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307300    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_175748.3-1755s21c1
Sequence:CCGGCAGTGCACCCAGGGTTATTTGCTCGAGCAAATAACCCTGGGTGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_175748.3-1090s21c1
Sequence:CCGGGCTGCAAACTTCAGGAGCTTACTCGAGTAAGCTCCTGAAGTTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018108
VALIDATED
UBR7 MISSION shRNA Bacterial Glycerol Stock
ubiquitin protein ligase E3 component n-recognin 7 (putative)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018108.2-725s1c1
Sequence:CCGGGCATCAAGATAGTACCCTCAACTCGAGTTGAGGGTACTATCTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018108.2-889s1c1
Sequence:CCGGGCTGCAAACTTCAGGAGCTTACTCGAGTAAGCTCCTGAAGTTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018108.2-905s1c1
Sequence:CCGGGCTTAAAGCTAAGCAGCTTATCTCGAGATAAGCTGCTTAGCTTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018108.2-1140s1c1
Sequence:CCGGCAAGTGGAACTCATTTGTGAACTCGAGTTCACAAATGAGTTCCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018108.2-586s1c1
Sequence:CCGGCCTGCATGAAACGTTGTTCTTCTCGAGAAGAACAACGTTTCATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018108
VALIDATED
UBR7 MISSION shRNA shRNA Plasmid DNA
ubiquitin protein ligase E3 component n-recognin 7 (putative)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018108.2-725s1c1
Sequence:CCGGGCATCAAGATAGTACCCTCAACTCGAGTTGAGGGTACTATCTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018108.2-889s1c1
Sequence:CCGGGCTGCAAACTTCAGGAGCTTACTCGAGTAAGCTCCTGAAGTTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018108.2-905s1c1
Sequence:CCGGGCTTAAAGCTAAGCAGCTTATCTCGAGATAAGCTGCTTAGCTTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018108.2-1140s1c1
Sequence:CCGGCAAGTGGAACTCATTTGTGAACTCGAGTTCACAAATGAGTTCCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018108.2-586s1c1
Sequence:CCGGCCTGCATGAAACGTTGTTCTTCTCGAGAAGAACAACGTTTCATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018108
VALIDATED
UBR7 MISSION shRNA Lentiviral Transduction Particles
ubiquitin protein ligase E3 component n-recognin 7 (putative)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018108.2-725s1c1
Sequence:CCGGGCATCAAGATAGTACCCTCAACTCGAGTTGAGGGTACTATCTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018108.2-889s1c1
Sequence:CCGGGCTGCAAACTTCAGGAGCTTACTCGAGTAAGCTCCTGAAGTTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018108.2-905s1c1
Sequence:CCGGGCTTAAAGCTAAGCAGCTTATCTCGAGATAAGCTGCTTAGCTTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018108.2-1140s1c1
Sequence:CCGGCAAGTGGAACTCATTTGTGAACTCGAGTTCACAAATGAGTTCCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018108.2-586s1c1
Sequence:CCGGCCTGCATGAAACGTTGTTCTTCTCGAGAAGAACAACGTTTCATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks