EMAIL THIS PAGE TO A FRIEND

UBTD1

ubiquitin domain containing 1

UniProtKB ID: Q9HAC8, D3DR57, Q53HI3
Gene ID:
Mouse(226122) ubiquitin domain containing 1
Rat(309373) ubiquitin domain containing 1
chicken(431558) ubiquitin domain containing 1
domestic cat(101100921) ubiquitin domain containing 1
dog(486821) ubiquitin domain containing 1
cow(506002) ubiquitin domain containing 1
sheep(101108793) ubiquitin domain containing 1
naked mole-rat(101698419) ubiquitin domain containing 1
domestic guinea pig(100720490) ubiquitin domain containing 1
112 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145500 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145500 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145500 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024954 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024954 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024954 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024954 Rosetta Predictions human pricing
NM_001013153 Rosetta Predictions rat pricing
XM_219869 Rosetta Predictions rat pricing
NM_145500 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024954 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173576 predicted 812
2 SASI_Hs01_00173577 predicted 290
3 SASI_Hs01_00173578 predicted 1019
4 SASI_Hs01_00173579 predicted 334
5 SASI_Hs01_00173580 predicted 340
6 SASI_Hs01_00173581 predicted 364
7 SASI_Hs01_00173582 predicted 271
8 SASI_Hs01_00173583 predicted 480
9 SASI_Hs02_00357614 predicted 1194
10 SASI_Hs01_00173584 predicted 504
11 SASI_Hs01_00173585 predicted 422
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013153 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042152 predicted 789
2 SASI_Rn01_00042153 predicted 592
3 SASI_Rn01_00042154 predicted 1289
4 SASI_Rn01_00042155 predicted 1048
5 SASI_Rn01_00042156 predicted 727
6 SASI_Rn01_00042157 predicted 1502
7 SASI_Rn02_00200881 predicted 961
8 SASI_Rn01_00042159 predicted 679
9 SASI_Rn01_00042160 predicted 705
10 SASI_Rn02_00200882 predicted 1104
11 SASI_Rn01_00042158 predicted 722
12 SASI_Rn01_00042161 predicted 690
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_219869 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00144987 predicted 256
2 SASI_Rn01_00144988 predicted 761
3 SASI_Rn01_00144989 predicted 515
4 SASI_Rn01_00144990 predicted 846
5 SASI_Rn01_00144991 predicted 247
6 SASI_Rn01_00144992 predicted 961
7 SASI_Rn01_00144993 predicted 432
8 SASI_Rn01_00144994 predicted 510
9 SASI_Rn01_00144995 predicted 967
10 SASI_Rn01_00144996 predicted 570
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145500 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111323 predicted 241
2 SASI_Mm01_00111324 predicted 778
3 SASI_Mm01_00111325 predicted 977
4 SASI_Mm01_00111326 predicted 395
5 SASI_Mm01_00111328 predicted 354
6 SASI_Mm01_00111330 predicted 730
7 SASI_Mm02_00340945 predicted 248
8 SASI_Mm01_00111332 predicted 621
9 SASI_Mm02_00340946 predicted 1306
10 SASI_Mm02_00340947 predicted 510
11 SASI_Mm01_00111327 predicted 785
12 SASI_Mm01_00111329 predicted 941
13 SASI_Mm01_00111331 predicted 647
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145500
UBTD1 MISSION shRNA Bacterial Glycerol Stock
ubiquitin domain containing 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000200367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145500.2-275s1c1
Sequence:CCGGGCTCAAGTGGAAGAGTGACTACTCGAGTAGTCACTCTTCCACTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145500.2-818s1c1
Sequence:CCGGCATCCAGGTCATCATCAACCACTCGAGTGGTTGATGATGACCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145500.2-405s1c1
Sequence:CCGGGCTGCTGAAGCTAATGACCATCTCGAGATGGTCATTAGCTTCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145500.2-785s1c1
Sequence:CCGGGCTCCAGGAAACAAAGATTCACTCGAGTGAATCTTTGTTTCCTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145500
UBTD1 MISSION shRNA shRNA Plasmid DNA
ubiquitin domain containing 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000200367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145500.2-275s1c1
Sequence:CCGGGCTCAAGTGGAAGAGTGACTACTCGAGTAGTCACTCTTCCACTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145500.2-818s1c1
Sequence:CCGGCATCCAGGTCATCATCAACCACTCGAGTGGTTGATGATGACCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145500.2-405s1c1
Sequence:CCGGGCTGCTGAAGCTAATGACCATCTCGAGATGGTCATTAGCTTCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145500.2-785s1c1
Sequence:CCGGGCTCCAGGAAACAAAGATTCACTCGAGTGAATCTTTGTTTCCTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145500
UBTD1 MISSION shRNA Lentiviral Transduction Particles
ubiquitin domain containing 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000200367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145500.2-275s1c1
Sequence:CCGGGCTCAAGTGGAAGAGTGACTACTCGAGTAGTCACTCTTCCACTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145500.2-818s1c1
Sequence:CCGGCATCCAGGTCATCATCAACCACTCGAGTGGTTGATGATGACCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145500.2-405s1c1
Sequence:CCGGGCTGCTGAAGCTAATGACCATCTCGAGATGGTCATTAGCTTCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145500.2-785s1c1
Sequence:CCGGGCTCCAGGAAACAAAGATTCACTCGAGTGAATCTTTGTTTCCTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024954
UBTD1 MISSION shRNA Bacterial Glycerol Stock
ubiquitin domain containing 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022439    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_024954.3-1382s1c1
Sequence:CCGGATTGGCAGAGATGAGGCGGGTCTCGAGACCCGCCTCATCTCTGCCAATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022442    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_024954.3-751s1c1
Sequence:CCGGATCGTGGCAGCGGTGGTTCTTCTCGAGAAGAACCACCGCTGCCACGATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024954.3-494s1c1
Sequence:CCGGACCCTCTGTGAATGCTACGATCTCGAGATCGTAGCATTCACAGAGGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024954.3-536s1c1
Sequence:CCGGCTGCCCATCTACTGCCTGTCACTCGAGTGACAGGCAGTAGATGGGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024954.3-496s1c1
Sequence:CCGGCCTCTGTGAATGCTACGATGACTCGAGTCATCGTAGCATTCACAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024954.3-277s21c1
Sequence:CCGGCCTGAAGAAAGAGCGGCTTAACTCGAGTTAAGCCGCTCTTTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024954.3-1076s21c1
Sequence:CCGGCCTTGCAACCTTGTCAGAGAACTCGAGTTCTCTGACAAGGTTGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024954.3-938s21c1
Sequence:CCGGTGCCTTCCAGTGCTGTCATTTCTCGAGAAATGACAGCACTGGAAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024954
UBTD1 MISSION shRNA shRNA Plasmid DNA
ubiquitin domain containing 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022439    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_024954.3-1382s1c1
Sequence:CCGGATTGGCAGAGATGAGGCGGGTCTCGAGACCCGCCTCATCTCTGCCAATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022442    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_024954.3-751s1c1
Sequence:CCGGATCGTGGCAGCGGTGGTTCTTCTCGAGAAGAACCACCGCTGCCACGATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024954.3-494s1c1
Sequence:CCGGACCCTCTGTGAATGCTACGATCTCGAGATCGTAGCATTCACAGAGGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024954.3-536s1c1
Sequence:CCGGCTGCCCATCTACTGCCTGTCACTCGAGTGACAGGCAGTAGATGGGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024954.3-496s1c1
Sequence:CCGGCCTCTGTGAATGCTACGATGACTCGAGTCATCGTAGCATTCACAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024954.3-277s21c1
Sequence:CCGGCCTGAAGAAAGAGCGGCTTAACTCGAGTTAAGCCGCTCTTTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024954.3-1076s21c1
Sequence:CCGGCCTTGCAACCTTGTCAGAGAACTCGAGTTCTCTGACAAGGTTGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024954.3-938s21c1
Sequence:CCGGTGCCTTCCAGTGCTGTCATTTCTCGAGAAATGACAGCACTGGAAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024954
UBTD1 MISSION shRNA Lentiviral Transduction Particles
ubiquitin domain containing 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022439    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_024954.3-1382s1c1
Sequence:CCGGATTGGCAGAGATGAGGCGGGTCTCGAGACCCGCCTCATCTCTGCCAATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022442    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_024954.3-751s1c1
Sequence:CCGGATCGTGGCAGCGGTGGTTCTTCTCGAGAAGAACCACCGCTGCCACGATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024954.3-494s1c1
Sequence:CCGGACCCTCTGTGAATGCTACGATCTCGAGATCGTAGCATTCACAGAGGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024954.3-536s1c1
Sequence:CCGGCTGCCCATCTACTGCCTGTCACTCGAGTGACAGGCAGTAGATGGGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024954.3-496s1c1
Sequence:CCGGCCTCTGTGAATGCTACGATGACTCGAGTCATCGTAGCATTCACAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024954.3-277s21c1
Sequence:CCGGCCTGAAGAAAGAGCGGCTTAACTCGAGTTAAGCCGCTCTTTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024954.3-1076s21c1
Sequence:CCGGCCTTGCAACCTTGTCAGAGAACTCGAGTTCTCTGACAAGGTTGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024954.3-938s21c1
Sequence:CCGGTGCCTTCCAGTGCTGTCATTTCTCGAGAAATGACAGCACTGGAAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks