EMAIL THIS PAGE TO A FRIEND

UBTD2

ubiquitin domain containing 2

Synonyms: DCUBP
UniProtKB ID: Q8WUN7, Q8TDQ3
Gene ID:
Mouse(327900) ubiquitin domain containing 2
Rat(287178) ubiquitin domain containing 2
Zebrafish(436991) ubiquitin domain containing 2
domestic cat(101092164) ubiquitin domain containing 2
dog(489120) ubiquitin domain containing 2
chicken(416202) ubiquitin domain containing 2
domestic guinea pig(100716836) ubiquitin domain containing 2
naked mole-rat(101699030) ubiquitin domain containing 2
cow(541134) ubiquitin domain containing 2
sheep(101107388) ubiquitin domain containing 2
177 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152277 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152277 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152277 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173784 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173784 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173784 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU012241 MISSION® esiRNA esiRNA targeting human UBTD2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152277 Rosetta Predictions human pricing
XM_001063674 Rosetta Predictions rat pricing
XM_213249 Rosetta Predictions rat pricing
NM_173784 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152277 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036266 predicted 529
2 SASI_Hs01_00036267 predicted 468
3 SASI_Hs01_00036271 predicted 887
4 SASI_Hs01_00036272 predicted 765
5 SASI_Hs02_00365812 predicted 523
6 SASI_Hs02_00365813 predicted 577
7 SASI_Hs01_00036273 predicted 375
8 SASI_Hs02_00365814 predicted 461
9 SASI_Hs02_00365815 predicted 613
10 SASI_Hs01_00036275 predicted 793
11 SASI_Hs01_00036268 predicted 783
12 SASI_Hs01_00036269 predicted 488
13 SASI_Hs01_00036270 predicted 790
14 SASI_Hs01_00036274 predicted 806
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063674 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00307973 predicted 448
2 SASI_Rn02_00307974 predicted 898
3 SASI_Rn02_00307975 predicted 277
4 SASI_Rn02_00307976 predicted 407
5 SASI_Rn02_00307977 predicted 275
6 SASI_Rn02_00307978 predicted 651
7 SASI_Rn02_00307979 predicted 806
8 SASI_Rn02_00307980 predicted 855
9 SASI_Rn02_00307981 predicted 798
10 SASI_Rn02_00307982 predicted 649
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213249 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374469 predicted 897
2 SASI_Rn02_00374470 predicted 884
3 SASI_Rn02_00374471 predicted 898
4 SASI_Rn02_00374472 predicted 904
5 SASI_Rn02_00374473 predicted 280
6 SASI_Rn02_00374474 predicted 410
7 SASI_Rn02_00374475 predicted 279
8 SASI_Rn02_00374476 predicted 979
9 SASI_Rn02_00374477 predicted 79
10 SASI_Rn02_00374478 predicted 401
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173784 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125769 predicted 905
2 SASI_Mm01_00125770 predicted 746
3 SASI_Mm01_00125771 predicted 949
4 SASI_Mm01_00125772 predicted 744
5 SASI_Mm01_00125773 predicted 909
6 SASI_Mm01_00125774 predicted 502
7 SASI_Mm01_00125775 predicted 814
8 SASI_Mm01_00125776 predicted 532
9 SASI_Mm01_00125777 predicted 373
10 SASI_Mm01_00125778 predicted 366
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152277
VALIDATED
UBTD2 MISSION shRNA Bacterial Glycerol Stock
ubiquitin domain containing 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152277.2-470s21c1
Sequence:CCGGGATATCAGCTTCCAGTGTATTCTCGAGAATACACTGGAAGCTGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152277.2-275s21c1
Sequence:CCGGTACGCAGCAAGAGGGATGAATCTCGAGATTCATCCCTCTTGCTGCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152277.2-653s21c1
Sequence:CCGGACATGAAGAGACGGTTGCATGCTCGAGCATGCAACCGTCTCTTCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152277.1-404s1c2
Sequence:CCGGCCACCACCCAATTCTGGATATCTCGAGATATCCAGAATTGGGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152277.2-769s21c1
Sequence:CCGGGACTATGTTGTACAGGTTATACTCGAGTATAACCTGTACAACATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152277.2-582s21c1
Sequence:CCGGTCAGCTTCGTTTGCGCCTTTCCTCGAGGAAAGGCGCAAACGAAGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152277.2-247s21c1
Sequence:CCGGAGCGATTATCCTATGACAGATCTCGAGATCTGTCATAGGATAATCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073163    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152277.1-870s1c1
Sequence:CCGGCCAGGCTTTGAGACTCATGTACTCGAGTACATGAGTCTCAAAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152277.1-376s1c1
Sequence:CCGGCGACATAGAGACTCTGGATATCTCGAGATATCCAGAGTCTCTATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152277.1-344s1c1
Sequence:CCGGGCACCGCCAATCAACATGATACTCGAGTATCATGTTGATTGGCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152277.1-260s1c1
Sequence:CCGGGCAAACATAACATTACCACATCTCGAGATGTGGTAATGTTATGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152277
VALIDATED
UBTD2 MISSION shRNA shRNA Plasmid DNA
ubiquitin domain containing 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152277.2-470s21c1
Sequence:CCGGGATATCAGCTTCCAGTGTATTCTCGAGAATACACTGGAAGCTGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152277.2-275s21c1
Sequence:CCGGTACGCAGCAAGAGGGATGAATCTCGAGATTCATCCCTCTTGCTGCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152277.2-653s21c1
Sequence:CCGGACATGAAGAGACGGTTGCATGCTCGAGCATGCAACCGTCTCTTCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152277.1-404s1c2
Sequence:CCGGCCACCACCCAATTCTGGATATCTCGAGATATCCAGAATTGGGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152277.2-769s21c1
Sequence:CCGGGACTATGTTGTACAGGTTATACTCGAGTATAACCTGTACAACATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152277.2-582s21c1
Sequence:CCGGTCAGCTTCGTTTGCGCCTTTCCTCGAGGAAAGGCGCAAACGAAGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152277.2-247s21c1
Sequence:CCGGAGCGATTATCCTATGACAGATCTCGAGATCTGTCATAGGATAATCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073163    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152277.1-870s1c1
Sequence:CCGGCCAGGCTTTGAGACTCATGTACTCGAGTACATGAGTCTCAAAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152277.1-376s1c1
Sequence:CCGGCGACATAGAGACTCTGGATATCTCGAGATATCCAGAGTCTCTATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152277.1-344s1c1
Sequence:CCGGGCACCGCCAATCAACATGATACTCGAGTATCATGTTGATTGGCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152277.1-260s1c1
Sequence:CCGGGCAAACATAACATTACCACATCTCGAGATGTGGTAATGTTATGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152277
VALIDATED
UBTD2 MISSION shRNA Lentiviral Transduction Particles
ubiquitin domain containing 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152277.2-470s21c1
Sequence:CCGGGATATCAGCTTCCAGTGTATTCTCGAGAATACACTGGAAGCTGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152277.2-275s21c1
Sequence:CCGGTACGCAGCAAGAGGGATGAATCTCGAGATTCATCCCTCTTGCTGCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152277.2-653s21c1
Sequence:CCGGACATGAAGAGACGGTTGCATGCTCGAGCATGCAACCGTCTCTTCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152277.1-404s1c2
Sequence:CCGGCCACCACCCAATTCTGGATATCTCGAGATATCCAGAATTGGGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152277.2-769s21c1
Sequence:CCGGGACTATGTTGTACAGGTTATACTCGAGTATAACCTGTACAACATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152277.2-582s21c1
Sequence:CCGGTCAGCTTCGTTTGCGCCTTTCCTCGAGGAAAGGCGCAAACGAAGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152277.2-247s21c1
Sequence:CCGGAGCGATTATCCTATGACAGATCTCGAGATCTGTCATAGGATAATCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073163    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152277.1-870s1c1
Sequence:CCGGCCAGGCTTTGAGACTCATGTACTCGAGTACATGAGTCTCAAAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152277.1-376s1c1
Sequence:CCGGCGACATAGAGACTCTGGATATCTCGAGATATCCAGAGTCTCTATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152277.1-344s1c1
Sequence:CCGGGCACCGCCAATCAACATGATACTCGAGTATCATGTTGATTGGCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152277.1-260s1c1
Sequence:CCGGGCAAACATAACATTACCACATCTCGAGATGTGGTAATGTTATGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173784
VALIDATED
UBTD2 MISSION shRNA Bacterial Glycerol Stock
ubiquitin domain containing 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216848    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173784.3-748s1c1
Sequence:CCGGGACTATGTGGTGCAGGTTATACTCGAGTATAACCTGCACCACATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173784.3-381s1c1
Sequence:CCGGCATTGACGGTGCAAACATAACCTCGAGGTTATGTTTGCACCGTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173784.3-627s1c1
Sequence:CCGGGTTTCACATGAAGAGGCGCTTCTCGAGAAGCGCCTCTTCATGTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181996    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173784.3-993s1c1
Sequence:CCGGCCAGCCTCTGATACTCTTATACTCGAGTATAAGAGTATCAGAGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173784.3-615s1c1
Sequence:CCGGCACAGACACAGTGTTTCACATCTCGAGATGTGAAACACTGTGTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173784.3-481s1c1
Sequence:CCGGCCAATCAACATGATAGAGGAACTCGAGTTCCTCTATCATGTTGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197801    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173784.3-1623s1c1
Sequence:CCGGGCAAGACAGAAATGGAGTATACTCGAGTATACTCCATTTCTGTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173784
VALIDATED
UBTD2 MISSION shRNA shRNA Plasmid DNA
ubiquitin domain containing 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216848    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173784.3-748s1c1
Sequence:CCGGGACTATGTGGTGCAGGTTATACTCGAGTATAACCTGCACCACATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173784.3-381s1c1
Sequence:CCGGCATTGACGGTGCAAACATAACCTCGAGGTTATGTTTGCACCGTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173784.3-627s1c1
Sequence:CCGGGTTTCACATGAAGAGGCGCTTCTCGAGAAGCGCCTCTTCATGTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181996    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173784.3-993s1c1
Sequence:CCGGCCAGCCTCTGATACTCTTATACTCGAGTATAAGAGTATCAGAGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173784.3-615s1c1
Sequence:CCGGCACAGACACAGTGTTTCACATCTCGAGATGTGAAACACTGTGTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173784.3-481s1c1
Sequence:CCGGCCAATCAACATGATAGAGGAACTCGAGTTCCTCTATCATGTTGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197801    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173784.3-1623s1c1
Sequence:CCGGGCAAGACAGAAATGGAGTATACTCGAGTATACTCCATTTCTGTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173784
VALIDATED
UBTD2 MISSION shRNA Lentiviral Transduction Particles
ubiquitin domain containing 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216848    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173784.3-748s1c1
Sequence:CCGGGACTATGTGGTGCAGGTTATACTCGAGTATAACCTGCACCACATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173784.3-381s1c1
Sequence:CCGGCATTGACGGTGCAAACATAACCTCGAGGTTATGTTTGCACCGTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173784.3-627s1c1
Sequence:CCGGGTTTCACATGAAGAGGCGCTTCTCGAGAAGCGCCTCTTCATGTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181996    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173784.3-993s1c1
Sequence:CCGGCCAGCCTCTGATACTCTTATACTCGAGTATAAGAGTATCAGAGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173784.3-615s1c1
Sequence:CCGGCACAGACACAGTGTTTCACATCTCGAGATGTGAAACACTGTGTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173784.3-481s1c1
Sequence:CCGGCCAATCAACATGATAGAGGAACTCGAGTTCCTCTATCATGTTGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197801    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173784.3-1623s1c1
Sequence:CCGGGCAAGACAGAAATGGAGTATACTCGAGTATACTCCATTTCTGTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks