EMAIL THIS PAGE TO A FRIEND

UBTF

upstream binding transcription factor, RNA polymerase I

Synonyms: NOR-90 UBF UBF-1 UBF1
UniProtKB ID: P17480, A8K6R8
Gene ID:
Human(7343) Summary: This gene encodes a member of the HMG-box DNA-binding protein family. The encoded protein plays a critical role in ribosomal RNA transcription as a key component of the pre-initiation complex, mediating the recruitment of RNA polymerase I to rDNA promoter regions. The encoded protein may also play important roles in chromatin remodeling and pre-rRNA processing, and its activity is regulated by both phosphorylation and acetylation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. Pseudogenes of this gene are located on the short arm of chromosomes 3, 11 and X and the long arm of chromosome 11. [provided by RefSeq, Aug 2011]
Mouse(21429) upstream binding transcription factor, RNA polymerase I
Rat(25574) upstream binding transcription factor, RNA polymerase I
cow(497012) upstream binding transcription factor, RNA polymerase I
sheep(101114372) upstream binding transcription factor, RNA polymerase I
naked mole-rat(101719434) upstream binding transcription factor, RNA polymerase I
domestic guinea pig(100721775) upstream binding transcription factor, RNA polymerase I
Zebrafish(368509) upstream binding transcription factor, RNA polymerase I
Horse(100064724) upstream binding transcription factor, RNA polymerase I
chicken(100859792) upstream binding transcription factor, RNA polymerase I
domestic cat(101099160) upstream binding transcription factor, RNA polymerase I
dog(480503) upstream binding transcription factor, RNA polymerase I
134 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4504737 Anti-phospho-UBF (pSer484) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4503056 Anti-UBF1 antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunohistochemistry, western blot pricing
HPA006385 Anti-UBTF antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB2102635 Anti-UBTF antibody produced in rabbit affinity isolated antibody human, mouse, rat, rabbit, canine, guinea pig, horse
western blot pricing
WH0007343M1 Monoclonal Anti-UBTF antibody produced in mouse clone 6B6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1404509 Monoclonal Anti-UBTF antibody produced in mouse clone 1A2, purified immunoglobulin, buffered aqueous solution human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1409785 Monoclonal Anti-UBTF antibody produced in mouse clone 6C6, purified immunoglobulin, buffered aqueous solution rat, human
ELISA, immunofluorescence, western blot pricing
SAB1409786 Monoclonal Anti-UBTF antibody produced in mouse clone 2C6, purified immunoglobulin, buffered aqueous solution rat, human
ELISA, western blot pricing
SAB1409787 Monoclonal Anti-UBTF antibody produced in mouse clone 2D8, purified immunoglobulin, buffered aqueous solution rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011551 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011551 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011551 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014233 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014233 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014233 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001076683 Rosetta Predictions human pricing
NM_001076684 Rosetta Predictions human pricing
NM_014233 Rosetta Predictions human pricing
NM_001105723 Rosetta Predictions rat pricing
NM_001127690 Rosetta Predictions rat pricing
NM_001044383 Rosetta Predictions mouse pricing
NM_011551 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001076683 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311994 predicted 446
2 SASI_Hs02_00311995 predicted 1335
3 SASI_Hs02_00311996 predicted 1769
4 SASI_Hs02_00311997 predicted 403
5 SASI_Hs02_00311998 predicted 591
6 SASI_Hs02_00311999 predicted 1709
7 SASI_Hs02_00312000 predicted 1805
8 SASI_Hs02_00312001 predicted 1120
9 SASI_Hs02_00312002 predicted 456
10 SASI_Hs02_00312003 predicted 1342
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001076684 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312004 predicted 417
2 SASI_Hs02_00312005 predicted 1296
3 SASI_Hs02_00312006 predicted 1739
4 SASI_Hs02_00312007 predicted 363
5 SASI_Hs02_00312008 predicted 554
6 SASI_Hs02_00312009 predicted 1678
7 SASI_Hs02_00312010 predicted 1777
8 SASI_Hs02_00312011 predicted 1087
9 SASI_Hs02_00312012 predicted 423
10 SASI_Hs02_00312013 predicted 1310
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014233 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144217 predicted 301
2 SASI_Hs01_00144218 predicted 1301
3 SASI_Hs01_00144219 predicted 1734
4 SASI_Hs01_00144223 predicted 253
5 SASI_Hs01_00144224 predicted 446
6 SASI_Hs01_00144225 predicted 1682
7 SASI_Hs01_00144226 predicted 1778
8 SASI_Hs02_00345267 predicted 1091
9 SASI_Hs02_00345268 predicted 310
10 SASI_Hs02_00345269 predicted 1310
11 SASI_Hs01_00144220 predicted 258
12 SASI_Hs01_00144221 predicted 811
13 SASI_Hs01_00144222 predicted 697
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105723 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211896 predicted 397
2 SASI_Rn02_00211897 predicted 1130
3 SASI_Rn02_00211898 predicted 1643
4 SASI_Rn02_00211899 predicted 416
5 SASI_Rn02_00211900 predicted 1627
6 SASI_Rn02_00211901 predicted 407
7 SASI_Rn02_00211902 predicted 441
8 SASI_Rn02_00211903 predicted 321
9 SASI_Rn02_00211904 predicted 441
10 SASI_Rn02_00211905 predicted 1441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127690 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254890 predicted 403
2 SASI_Rn02_00254891 predicted 1235
3 SASI_Rn02_00254892 predicted 1749
4 SASI_Rn02_00254893 predicted 409
5 SASI_Rn02_00254894 predicted 1741
6 SASI_Rn02_00254895 predicted 409
7 SASI_Rn02_00254896 predicted 435
8 SASI_Rn02_00254897 predicted 317
9 SASI_Rn02_00254898 predicted 437
10 SASI_Rn02_00254899 predicted 1558
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044383 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291254 predicted 1559
2 SASI_Mm02_00291255 predicted 1196
3 SASI_Mm02_00291256 predicted 383
4 SASI_Mm02_00291257 predicted 414
5 SASI_Mm02_00291258 predicted 384
6 SASI_Mm02_00291259 predicted 603
7 SASI_Mm02_00291260 predicted 1036
8 SASI_Mm02_00291261 predicted 405
9 SASI_Mm02_00291262 predicted 1559
10 SASI_Mm02_00291263 predicted 426
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011551 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165359 predicted 1803
2 SASI_Mm02_00320902 predicted 1444
3 SASI_Mm01_00165360 predicted 514
4 SASI_Mm02_00320903 predicted 548
5 SASI_Mm02_00320904 predicted 515
6 SASI_Mm01_00165361 predicted 732
7 SASI_Mm01_00165362 predicted 1284
8 SASI_Mm01_00165363 predicted 539
9 SASI_Mm02_00320905 predicted 1801
10 SASI_Mm01_00165365 predicted 558
11 SASI_Mm01_00165358 predicted 242
12 SASI_Mm01_00165364 predicted 1572
13 SASI_Mm01_00165366 predicted 1755
14 SASI_Mm01_00165367 predicted 605
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011551
VALIDATED
UBTF MISSION shRNA Bacterial Glycerol Stock
upstream binding transcription factor, RNA polymerase I
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096689    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011551.3-2420s1c1
Sequence:CCGGCCAACAGACAACCTTTGACAACTCGAGTTGTCAAAGGTTGTCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011551.3-1973s1c1
Sequence:CCGGCCGCGCAGCATACAAAGAATACTCGAGTATTCTTTGTATGCTGCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011551.3-819s1c1
Sequence:CCGGGAGGAGATTATGCGGGACTATCTCGAGATAGTCCCGCATAATCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011551.3-362s1c1
Sequence:CCGGGCTCAAGAAACACCCGGATTTCTCGAGAAATCCGGGTGTTTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011551.3-473s1c1
Sequence:CCGGCCTGACTAAGATCCTGTCTAACTCGAGTTAGACAGGATCTTAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011551.5-1087s21c1
Sequence:CCGGGGAGATTATGCGGGACTATATCTCGAGATATAGTCCCGCATAATCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225759    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011551.5-3966s21c1
Sequence:CCGGTCAGTCCCTTGACGGTGAAATCTCGAGATTTCACCGTCAAGGGACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011551.5-510s21c1
Sequence:GTACCGGGAGATATGTGCAAGCTCAAATCTCGAGATTTGAGCTTGCACATATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011551.5-2143s21c1
Sequence:CCGGGAGCCAGAAGGAGCACTATAACTCGAGTTATAGTGCTCCTTCTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011551.5-628s21c1
Sequence:CCGGGCTCAAGAAACACCCGGATTTCTCGAGAAATCCGGGTGTTTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011551
VALIDATED
UBTF MISSION shRNA shRNA Plasmid DNA
upstream binding transcription factor, RNA polymerase I
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096689    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011551.3-2420s1c1
Sequence:CCGGCCAACAGACAACCTTTGACAACTCGAGTTGTCAAAGGTTGTCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011551.3-1973s1c1
Sequence:CCGGCCGCGCAGCATACAAAGAATACTCGAGTATTCTTTGTATGCTGCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011551.3-819s1c1
Sequence:CCGGGAGGAGATTATGCGGGACTATCTCGAGATAGTCCCGCATAATCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011551.3-362s1c1
Sequence:CCGGGCTCAAGAAACACCCGGATTTCTCGAGAAATCCGGGTGTTTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011551.3-473s1c1
Sequence:CCGGCCTGACTAAGATCCTGTCTAACTCGAGTTAGACAGGATCTTAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011551.5-1087s21c1
Sequence:CCGGGGAGATTATGCGGGACTATATCTCGAGATATAGTCCCGCATAATCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225759    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011551.5-3966s21c1
Sequence:CCGGTCAGTCCCTTGACGGTGAAATCTCGAGATTTCACCGTCAAGGGACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011551.5-510s21c1
Sequence:GTACCGGGAGATATGTGCAAGCTCAAATCTCGAGATTTGAGCTTGCACATATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011551.5-2143s21c1
Sequence:CCGGGAGCCAGAAGGAGCACTATAACTCGAGTTATAGTGCTCCTTCTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011551.5-628s21c1
Sequence:CCGGGCTCAAGAAACACCCGGATTTCTCGAGAAATCCGGGTGTTTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011551
VALIDATED
UBTF MISSION shRNA Lentiviral Transduction Particles
upstream binding transcription factor, RNA polymerase I
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096689    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011551.3-2420s1c1
Sequence:CCGGCCAACAGACAACCTTTGACAACTCGAGTTGTCAAAGGTTGTCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011551.3-1973s1c1
Sequence:CCGGCCGCGCAGCATACAAAGAATACTCGAGTATTCTTTGTATGCTGCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011551.3-819s1c1
Sequence:CCGGGAGGAGATTATGCGGGACTATCTCGAGATAGTCCCGCATAATCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011551.3-362s1c1
Sequence:CCGGGCTCAAGAAACACCCGGATTTCTCGAGAAATCCGGGTGTTTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011551.3-473s1c1
Sequence:CCGGCCTGACTAAGATCCTGTCTAACTCGAGTTAGACAGGATCTTAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011551.5-1087s21c1
Sequence:CCGGGGAGATTATGCGGGACTATATCTCGAGATATAGTCCCGCATAATCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225759    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011551.5-3966s21c1
Sequence:CCGGTCAGTCCCTTGACGGTGAAATCTCGAGATTTCACCGTCAAGGGACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011551.5-510s21c1
Sequence:GTACCGGGAGATATGTGCAAGCTCAAATCTCGAGATTTGAGCTTGCACATATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011551.5-2143s21c1
Sequence:CCGGGAGCCAGAAGGAGCACTATAACTCGAGTTATAGTGCTCCTTCTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011551.5-628s21c1
Sequence:CCGGGCTCAAGAAACACCCGGATTTCTCGAGAAATCCGGGTGTTTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014233
VALIDATED
UBTF MISSION shRNA Bacterial Glycerol Stock
upstream binding transcription factor, RNA polymerase I
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020619    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014233.1-2549s1c1
Sequence:CCGGCCCACTTTCTTTCTTTCTTTACTCGAGTAAAGAAAGAAAGAAAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014233.1-1171s1c1
Sequence:CCGGGCCTATCACAAGAAGTGTGATCTCGAGATCACACTTCTTGTGATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014233.1-2070s1c1
Sequence:CCGGCCGTGCAGCATATAAAGAGTACTCGAGTACTCTTTATATGCTGCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_014233.1-570s1c1
Sequence:CCGGCCTAACCAAGATTCTGTCCAACTCGAGTTGGACAGAATCTTGGTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014233.1-393s1c1
Sequence:CCGGCCGTACATTGACAGAATTGATCTCGAGATCAATTCTGTCAATGTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_014233.2-839s21c1
Sequence:CCGGGAGATCATGAGAGACTATATCCTCGAGGATATAGTCTCTCATGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_014233.2-1985s21c1
Sequence:CCGGCAGGACCGTGCAGCATATAAACTCGAGTTTATATGCTGCACGGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235712    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014233.2-3839s21c1
Sequence:CCGGGTCATGTCACTGACCTATTAACTCGAGTTAATAGGTCAGTGACATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014233.2-337s21c1
Sequence:CCGGCGATGCTCAGGAACATGTTAACTCGAGTTAACATGTTCCTGAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014233
VALIDATED
UBTF MISSION shRNA shRNA Plasmid DNA
upstream binding transcription factor, RNA polymerase I
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020619    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014233.1-2549s1c1
Sequence:CCGGCCCACTTTCTTTCTTTCTTTACTCGAGTAAAGAAAGAAAGAAAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014233.1-1171s1c1
Sequence:CCGGGCCTATCACAAGAAGTGTGATCTCGAGATCACACTTCTTGTGATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014233.1-2070s1c1
Sequence:CCGGCCGTGCAGCATATAAAGAGTACTCGAGTACTCTTTATATGCTGCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_014233.1-570s1c1
Sequence:CCGGCCTAACCAAGATTCTGTCCAACTCGAGTTGGACAGAATCTTGGTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014233.1-393s1c1
Sequence:CCGGCCGTACATTGACAGAATTGATCTCGAGATCAATTCTGTCAATGTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_014233.2-839s21c1
Sequence:CCGGGAGATCATGAGAGACTATATCCTCGAGGATATAGTCTCTCATGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_014233.2-1985s21c1
Sequence:CCGGCAGGACCGTGCAGCATATAAACTCGAGTTTATATGCTGCACGGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235712    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014233.2-3839s21c1
Sequence:CCGGGTCATGTCACTGACCTATTAACTCGAGTTAATAGGTCAGTGACATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014233.2-337s21c1
Sequence:CCGGCGATGCTCAGGAACATGTTAACTCGAGTTAACATGTTCCTGAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014233
VALIDATED
UBTF MISSION shRNA Lentiviral Transduction Particles
upstream binding transcription factor, RNA polymerase I
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020619    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014233.1-2549s1c1
Sequence:CCGGCCCACTTTCTTTCTTTCTTTACTCGAGTAAAGAAAGAAAGAAAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014233.1-1171s1c1
Sequence:CCGGGCCTATCACAAGAAGTGTGATCTCGAGATCACACTTCTTGTGATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014233.1-2070s1c1
Sequence:CCGGCCGTGCAGCATATAAAGAGTACTCGAGTACTCTTTATATGCTGCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_014233.1-570s1c1
Sequence:CCGGCCTAACCAAGATTCTGTCCAACTCGAGTTGGACAGAATCTTGGTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014233.1-393s1c1
Sequence:CCGGCCGTACATTGACAGAATTGATCTCGAGATCAATTCTGTCAATGTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_014233.2-839s21c1
Sequence:CCGGGAGATCATGAGAGACTATATCCTCGAGGATATAGTCTCTCATGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_014233.2-1985s21c1
Sequence:CCGGCAGGACCGTGCAGCATATAAACTCGAGTTTATATGCTGCACGGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235712    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014233.2-3839s21c1
Sequence:CCGGGTCATGTCACTGACCTATTAACTCGAGTTAATAGGTCAGTGACATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014233.2-337s21c1
Sequence:CCGGCGATGCTCAGGAACATGTTAACTCGAGTTAACATGTTCCTGAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks