EMAIL THIS PAGE TO A FRIEND

UBTFL1

upstream binding transcription factor, RNA polymerase I-like 1

Synonyms: C11orf27 HMGPI
UniProtKB ID: P0CB47, C9JMX8
Gene ID:
Human(642623) Summary: UBTFL1 is a preimplantation-specific gene and is involved in early development, implantation, and embryonic stem (ES) cell derivation (summary by Yamada et al., 2010 [PubMed 19915186]
Mouse(546118) upstream binding transcription factor, RNA polymerase I-like 1
Rat(300386) upstream binding transcription factor, RNA polymerase I-like 1
naked mole-rat(101721823) upstream binding transcription factor, RNA polymerase I-like 1
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV51038 Anti-LOC642623 antibody produced in rabbit affinity isolated antibody human, guinea pig
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033793 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033793 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033793 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU189191 MISSION® esiRNA esiRNA targeting mouse Ubtfl1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001726345 Rosetta Predictions human pricing
XM_926094 Rosetta Predictions human pricing
XM_001075304 Rosetta Predictions rat pricing
XM_235881 Rosetta Predictions rat pricing
NM_001033793 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001726345 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00473712 predicted 835
2 SASI_Hs02_00473713 predicted 716
3 SASI_Hs02_00473714 predicted 717
4 SASI_Hs02_00473715 predicted 546
5 SASI_Hs02_00473716 predicted 325
6 SASI_Hs02_00473717 predicted 410
7 SASI_Hs02_00473718 predicted 524
8 SASI_Hs02_00473719 predicted 553
9 SASI_Hs02_00473720 predicted 1050
10 SASI_Hs02_00473721 predicted 82
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_926094 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00480300 predicted 833
2 SASI_Hs02_00480301 predicted 720
3 SASI_Hs02_00480302 predicted 721
4 SASI_Hs02_00480303 predicted 553
5 SASI_Hs02_00480304 predicted 287
6 SASI_Hs02_00480305 predicted 325
7 SASI_Hs02_00480306 predicted 405
8 SASI_Hs02_00480307 predicted 523
9 SASI_Hs02_00480308 predicted 555
10 SASI_Hs02_00480309 predicted 1044
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075304 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00349242 predicted 693
2 SASI_Rn02_00349243 predicted 792
3 SASI_Rn02_00349244 predicted 435
4 SASI_Rn02_00349245 predicted 589
5 SASI_Rn02_00349246 predicted 462
6 SASI_Rn02_00349247 predicted 669
7 SASI_Rn02_00349248 predicted 345
8 SASI_Rn02_00349249 predicted 215
9 SASI_Rn02_00349250 predicted 691
10 SASI_Rn02_00349251 predicted 758
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235881 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389716 predicted 699
2 SASI_Rn02_00389717 predicted 786
3 SASI_Rn02_00389718 predicted 438
4 SASI_Rn02_00389719 predicted 590
5 SASI_Rn02_00389720 predicted 466
6 SASI_Rn02_00389721 predicted 670
7 SASI_Rn02_00389722 predicted 338
8 SASI_Rn02_00389723 predicted 214
9 SASI_Rn02_00389724 predicted 687
10 SASI_Rn02_00389725 predicted 760
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033793 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050375 predicted 869
2 SASI_Mm01_00050376 predicted 1515
3 SASI_Mm01_00050377 predicted 929
4 SASI_Mm01_00050378 predicted 988
5 SASI_Mm01_00050379 predicted 930
6 SASI_Mm01_00050380 predicted 824
7 SASI_Mm01_00050381 predicted 937
8 SASI_Mm01_00050382 predicted 1377
9 SASI_Mm01_00050383 predicted 1462
10 SASI_Mm01_00050384 predicted 1412
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033793
UBTFL1 MISSION shRNA Bacterial Glycerol Stock
upstream binding transcription factor, RNA polymerase I-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033793.3-522s21c1
Sequence:CCGGTTCCGCACACTGACAGAATTACTCGAGTAATTCTGTCAGTGTGCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033793.3-892s21c1
Sequence:CCGGCGAAGTCACAAGGAGATATAACTCGAGTTATATCTCCTTGTGACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033793.3-1480s21c1
Sequence:CCGGGTACAGATGAAGATGATTAAACTCGAGTTTAATCATCTTCATCTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033793.3-370s21c1
Sequence:CCGGTGGAATGCATGGAGCATAATACTCGAGTATTATGCTCCATGCATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239681    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033793.3-1864s21c1
Sequence:CCGGTGCTGTGGCAAACGGTAAATACTCGAGTATTTACCGTTTGCCACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033793
UBTFL1 MISSION shRNA shRNA Plasmid DNA
upstream binding transcription factor, RNA polymerase I-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033793.3-522s21c1
Sequence:CCGGTTCCGCACACTGACAGAATTACTCGAGTAATTCTGTCAGTGTGCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033793.3-892s21c1
Sequence:CCGGCGAAGTCACAAGGAGATATAACTCGAGTTATATCTCCTTGTGACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033793.3-1480s21c1
Sequence:CCGGGTACAGATGAAGATGATTAAACTCGAGTTTAATCATCTTCATCTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033793.3-370s21c1
Sequence:CCGGTGGAATGCATGGAGCATAATACTCGAGTATTATGCTCCATGCATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239681    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033793.3-1864s21c1
Sequence:CCGGTGCTGTGGCAAACGGTAAATACTCGAGTATTTACCGTTTGCCACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033793
UBTFL1 MISSION shRNA Lentiviral Transduction Particles
upstream binding transcription factor, RNA polymerase I-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033793.3-522s21c1
Sequence:CCGGTTCCGCACACTGACAGAATTACTCGAGTAATTCTGTCAGTGTGCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033793.3-892s21c1
Sequence:CCGGCGAAGTCACAAGGAGATATAACTCGAGTTATATCTCCTTGTGACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033793.3-1480s21c1
Sequence:CCGGGTACAGATGAAGATGATTAAACTCGAGTTTAATCATCTTCATCTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033793.3-370s21c1
Sequence:CCGGTGGAATGCATGGAGCATAATACTCGAGTATTATGCTCCATGCATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239681    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033793.3-1864s21c1
Sequence:CCGGTGCTGTGGCAAACGGTAAATACTCGAGTATTTACCGTTTGCCACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks