EMAIL THIS PAGE TO A FRIEND

UBTFL2

upstream binding transcription factor, RNA polymerase I-like 2 (pseudogene)

Species: Human UBTFL2(120126)
Gene ID:
9 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001101321 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001101321 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001101321 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001101321 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101321 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322606 predicted 833
2 SASI_Hs02_00322607 predicted 318
3 SASI_Hs02_00322608 predicted 546
4 SASI_Hs02_00322609 predicted 409
5 SASI_Hs02_00322610 predicted 524
6 SASI_Hs02_00322611 predicted 320
7 SASI_Hs02_00322612 predicted 546
8 SASI_Hs02_00322613 predicted 1045
9 SASI_Hs02_00322614 predicted 83
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001101321
UBTFL2 MISSION shRNA Bacterial Glycerol Stock
upstream binding transcription factor, RNA polymerase I-like 2 (pseudogene)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000237923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101321.1-92s21c1
Sequence:CCGGCTGATGACAACAGCACGTTTACTCGAGTAAACGTGCTGTTGTCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101321.1-839s21c1
Sequence:CCGGAGAAGCAATACAAGGTGAAATCTCGAGATTTCACCTTGTATTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101321.1-917s21c1
Sequence:CCGGCCTATGCTAAGGGTAAGAATACTCGAGTATTCTTACCCTTAGCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101321.1-795s21c1
Sequence:CCGGGCAGAGCCAGAAGGATCATTTCTCGAGAAATGATCCTTCTGGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101321.1-709s21c1
Sequence:CCGGCAAGATTCCTGGTCAAGTAAACTCGAGTTTACTTGACCAGGAATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001101321
UBTFL2 MISSION shRNA shRNA Plasmid DNA
upstream binding transcription factor, RNA polymerase I-like 2 (pseudogene)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000237923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101321.1-92s21c1
Sequence:CCGGCTGATGACAACAGCACGTTTACTCGAGTAAACGTGCTGTTGTCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101321.1-839s21c1
Sequence:CCGGAGAAGCAATACAAGGTGAAATCTCGAGATTTCACCTTGTATTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101321.1-917s21c1
Sequence:CCGGCCTATGCTAAGGGTAAGAATACTCGAGTATTCTTACCCTTAGCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101321.1-795s21c1
Sequence:CCGGGCAGAGCCAGAAGGATCATTTCTCGAGAAATGATCCTTCTGGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101321.1-709s21c1
Sequence:CCGGCAAGATTCCTGGTCAAGTAAACTCGAGTTTACTTGACCAGGAATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001101321
UBTFL2 MISSION shRNA Lentiviral Transduction Particles
upstream binding transcription factor, RNA polymerase I-like 2 (pseudogene)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000237923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101321.1-92s21c1
Sequence:CCGGCTGATGACAACAGCACGTTTACTCGAGTAAACGTGCTGTTGTCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101321.1-839s21c1
Sequence:CCGGAGAAGCAATACAAGGTGAAATCTCGAGATTTCACCTTGTATTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101321.1-917s21c1
Sequence:CCGGCCTATGCTAAGGGTAAGAATACTCGAGTATTCTTACCCTTAGCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101321.1-795s21c1
Sequence:CCGGGCAGAGCCAGAAGGATCATTTCTCGAGAAATGATCCTTCTGGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101321.1-709s21c1
Sequence:CCGGCAAGATTCCTGGTCAAGTAAACTCGAGTTTACTTGACCAGGAATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks