EMAIL THIS PAGE TO A FRIEND

UBTFL3

upstream binding transcription factor, RNA polymerase I-like 3 (pseudogene)

Synonyms: UBTFL5
Species: Human UBTFL3(129870)
Gene ID:
18 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_001714624 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_001714624 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_001714624 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001714624 Rosetta Predictions human pricing
XM_065445 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714624 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00398333 predicted 326
2 SASI_Hs02_00398334 predicted 574
3 SASI_Hs02_00398335 predicted 461
4 SASI_Hs02_00398336 predicted 848
5 SASI_Hs02_00398337 predicted 890
6 SASI_Hs02_00398338 predicted 78
7 SASI_Hs02_00398339 predicted 11
8 SASI_Hs02_00398340 predicted 1115
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_065445 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00478753 predicted 495
2 SASI_Hs02_00478754 predicted 737
3 SASI_Hs02_00478755 predicted 1016
4 SASI_Hs02_00478756 predicted 737
5 SASI_Hs02_00478757 predicted 1055
6 SASI_Hs02_00478758 predicted 154
7 SASI_Hs02_00478759 predicted 80
8 SASI_Hs02_00478760 predicted 155
9 SASI_Hs02_00478761 predicted 164
10 SASI_Hs02_00478762 predicted 1280
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001714624
UBTFL3 MISSION shRNA Bacterial Glycerol Stock
upstream binding transcription factor, RNA polymerase I-like 3 (pseudogene)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714624.1-324s21c1
Sequence:CCGGGAGGCTCCTTACTGCTTATATCTCGAGATATAAGCAGTAAGGAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714624.1-807s21c1
Sequence:CCGGGCAGAGCCAGAAGGATCATTACTCGAGTAATGATCCTTCTGGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714624.1-721s21c1
Sequence:CCGGCAAGATTCCTGGTCAAGTAAGCTCGAGCTTACTTGACCAGGAATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714624.1-930s21c1
Sequence:CCGGCTATGCTAAGGGTAAGAATATCTCGAGATATTCTTACCCTTAGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714624.1-542s21c1
Sequence:CCGGTAGACCAGAAGGGCAAGAAATCTCGAGATTTCTTGCCCTTCTGGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001714624
UBTFL3 MISSION shRNA shRNA Plasmid DNA
upstream binding transcription factor, RNA polymerase I-like 3 (pseudogene)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714624.1-324s21c1
Sequence:CCGGGAGGCTCCTTACTGCTTATATCTCGAGATATAAGCAGTAAGGAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714624.1-807s21c1
Sequence:CCGGGCAGAGCCAGAAGGATCATTACTCGAGTAATGATCCTTCTGGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714624.1-721s21c1
Sequence:CCGGCAAGATTCCTGGTCAAGTAAGCTCGAGCTTACTTGACCAGGAATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714624.1-930s21c1
Sequence:CCGGCTATGCTAAGGGTAAGAATATCTCGAGATATTCTTACCCTTAGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714624.1-542s21c1
Sequence:CCGGTAGACCAGAAGGGCAAGAAATCTCGAGATTTCTTGCCCTTCTGGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001714624
UBTFL3 MISSION shRNA Lentiviral Transduction Particles
upstream binding transcription factor, RNA polymerase I-like 3 (pseudogene)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714624.1-324s21c1
Sequence:CCGGGAGGCTCCTTACTGCTTATATCTCGAGATATAAGCAGTAAGGAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714624.1-807s21c1
Sequence:CCGGGCAGAGCCAGAAGGATCATTACTCGAGTAATGATCCTTCTGGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714624.1-721s21c1
Sequence:CCGGCAAGATTCCTGGTCAAGTAAGCTCGAGCTTACTTGACCAGGAATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714624.1-930s21c1
Sequence:CCGGCTATGCTAAGGGTAAGAATATCTCGAGATATTCTTACCCTTAGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714624.1-542s21c1
Sequence:CCGGTAGACCAGAAGGGCAAGAAATCTCGAGATTTCTTGCCCTTCTGGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks