EMAIL THIS PAGE TO A FRIEND

UBXN10

UBX domain protein 10

Synonyms: UBXD3
UniProtKB ID: Q96LJ8, Q5R386
Gene ID:
Mouse(212190) UBX domain protein 10
Rat(298577) UBX domain protein 10
domestic guinea pig(100721895) UBX domain protein 10
naked mole-rat(101712040) UBX domain protein 10
cow(538586) UBX domain protein 10
sheep(101103384) UBX domain protein 10
Zebrafish(751736) UBX domain protein 10
chicken(771670) UBX domain protein 10
domestic cat(101092128) UBX domain protein 10
dog(487395) UBX domain protein 10
93 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152376 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152376 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152376 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178671 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178671 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178671 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152376 Rosetta Predictions human pricing
NM_001013093 Rosetta Predictions rat pricing
NM_178671 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152376 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217656 predicted 1373
2 SASI_Hs01_00217657 predicted 668
3 SASI_Hs01_00217659 predicted 1259
4 SASI_Hs02_00366029 predicted 1170
5 SASI_Hs01_00217660 predicted 1340
6 SASI_Hs01_00217661 predicted 507
7 SASI_Hs01_00217662 predicted 717
8 SASI_Hs01_00217663 predicted 985
9 SASI_Hs01_00217664 predicted 1384
10 SASI_Hs01_00217665 predicted 1338
11 SASI_Hs01_00217658 predicted 1197
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013093 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060411 predicted 336
2 SASI_Rn01_00060413 predicted 1309
3 SASI_Rn01_00060414 predicted 736
4 SASI_Rn01_00060415 predicted 351
5 SASI_Rn01_00060416 predicted 1193
6 SASI_Rn01_00060417 predicted 524
7 SASI_Rn01_00060418 predicted 1291
8 SASI_Rn01_00060420 predicted 1235
9 SASI_Rn02_00200746 predicted 528
10 SASI_Rn02_00200747 predicted 982
11 SASI_Rn01_00060412 predicted 542
12 SASI_Rn01_00060419 predicted 574
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178671 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036648 predicted 1359
2 SASI_Mm01_00036649 predicted 1655
3 SASI_Mm02_00349130 predicted 1652
4 SASI_Mm02_00349131 predicted 1659
5 SASI_Mm01_00036650 predicted 1166
6 SASI_Mm01_00036651 predicted 615
7 SASI_Mm01_00036652 predicted 1704
8 SASI_Mm01_00036653 predicted 580
9 SASI_Mm02_00349132 predicted 1629
10 SASI_Mm02_00349133 predicted 575
11 SASI_Mm01_00036647 predicted 1495
12 SASI_Mm01_00036654 predicted 1188
13 SASI_Mm01_00036655 predicted 1636
14 SASI_Mm01_00036656 predicted 1445
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152376
UBXN10 MISSION shRNA Bacterial Glycerol Stock
UBX domain protein 10
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011167    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152376.2-1293s1c1
Sequence:CCGGGCCAATGCTTTCCTGTCTGTACTCGAGTACAGACAGGAAAGCATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152376.2-434s1c1
Sequence:CCGGCCTTCCTTCCATCAACAGAAACTCGAGTTTCTGTTGATGGAAGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152376.2-709s1c1
Sequence:CCGGGCCAAAGGTTTGTACGCCATTCTCGAGAATGGCGTACAAACCTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152376.2-616s1c1
Sequence:CCGGGAACCAAGAAACAGGGCTCTTCTCGAGAAGAGCCCTGTTTCTTGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152376.2-167s1c1
Sequence:CCGGGCAGCCAAACTCACTAAATATCTCGAGATATTTAGTGAGTTTGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152376.3-1340s21c1
Sequence:CCGGGAGGATTCTAGTCTGGTAAATCTCGAGATTTACCAGACTAGAATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152376.3-254s21c1
Sequence:CCGGAGGTGTGCGCTCATCATATACCTCGAGGTATATGATGAGCGCACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152376.3-792s21c1
Sequence:CCGGCCGACACTGCAGCATTGAAACCTCGAGGTTTCAATGCTGCAGTGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152376.3-1365s21c1
Sequence:CCGGACAGTGTAGGAACTATCTAACCTCGAGGTTAGATAGTTCCTACACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152376
UBXN10 MISSION shRNA shRNA Plasmid DNA
UBX domain protein 10
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011167    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152376.2-1293s1c1
Sequence:CCGGGCCAATGCTTTCCTGTCTGTACTCGAGTACAGACAGGAAAGCATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152376.2-434s1c1
Sequence:CCGGCCTTCCTTCCATCAACAGAAACTCGAGTTTCTGTTGATGGAAGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152376.2-709s1c1
Sequence:CCGGGCCAAAGGTTTGTACGCCATTCTCGAGAATGGCGTACAAACCTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152376.2-616s1c1
Sequence:CCGGGAACCAAGAAACAGGGCTCTTCTCGAGAAGAGCCCTGTTTCTTGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152376.2-167s1c1
Sequence:CCGGGCAGCCAAACTCACTAAATATCTCGAGATATTTAGTGAGTTTGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152376.3-1340s21c1
Sequence:CCGGGAGGATTCTAGTCTGGTAAATCTCGAGATTTACCAGACTAGAATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152376.3-254s21c1
Sequence:CCGGAGGTGTGCGCTCATCATATACCTCGAGGTATATGATGAGCGCACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152376.3-792s21c1
Sequence:CCGGCCGACACTGCAGCATTGAAACCTCGAGGTTTCAATGCTGCAGTGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152376.3-1365s21c1
Sequence:CCGGACAGTGTAGGAACTATCTAACCTCGAGGTTAGATAGTTCCTACACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152376
UBXN10 MISSION shRNA Lentiviral Transduction Particles
UBX domain protein 10
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011167    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152376.2-1293s1c1
Sequence:CCGGGCCAATGCTTTCCTGTCTGTACTCGAGTACAGACAGGAAAGCATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152376.2-434s1c1
Sequence:CCGGCCTTCCTTCCATCAACAGAAACTCGAGTTTCTGTTGATGGAAGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152376.2-709s1c1
Sequence:CCGGGCCAAAGGTTTGTACGCCATTCTCGAGAATGGCGTACAAACCTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152376.2-616s1c1
Sequence:CCGGGAACCAAGAAACAGGGCTCTTCTCGAGAAGAGCCCTGTTTCTTGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152376.2-167s1c1
Sequence:CCGGGCAGCCAAACTCACTAAATATCTCGAGATATTTAGTGAGTTTGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152376.3-1340s21c1
Sequence:CCGGGAGGATTCTAGTCTGGTAAATCTCGAGATTTACCAGACTAGAATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152376.3-254s21c1
Sequence:CCGGAGGTGTGCGCTCATCATATACCTCGAGGTATATGATGAGCGCACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152376.3-792s21c1
Sequence:CCGGCCGACACTGCAGCATTGAAACCTCGAGGTTTCAATGCTGCAGTGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152376.3-1365s21c1
Sequence:CCGGACAGTGTAGGAACTATCTAACCTCGAGGTTAGATAGTTCCTACACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178671
UBXN10 MISSION shRNA Bacterial Glycerol Stock
UBX domain protein 10
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178671.2-977s1c1
Sequence:CCGGCTTAGAGAAGAAGTTCATCATCTCGAGATGATGAACTTCTTCTCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178671.3-1250s21c1
Sequence:CCGGATGCGGCATCCTTCATAAATCCTCGAGGATTTATGAAGGATGCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178671.3-1094s21c1
Sequence:CCGGCCAAAGGTTCGTGCGCTATTTCTCGAGAAATAGCGCACGAACCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178671.3-925s1c1
Sequence:CCGGCCCTTTACCAAGAGGATTCAACTCGAGTTGAATCCTCTTGGTAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178671.3-569s21c1
Sequence:CCGGCTCACTCAGGATGCACGTTATCTCGAGATAACGTGCATCCTGAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178671.3-2119s21c1
Sequence:CCGGCCTACTTGAGCACAGGTAAATCTCGAGATTTACCTGTGCTCAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178671.3-925s21c1
Sequence:CCGGCCCTTTACCAAGAGGATTCAACTCGAGTTGAATCCTCTTGGTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178671
UBXN10 MISSION shRNA shRNA Plasmid DNA
UBX domain protein 10
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178671.2-977s1c1
Sequence:CCGGCTTAGAGAAGAAGTTCATCATCTCGAGATGATGAACTTCTTCTCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178671.3-1250s21c1
Sequence:CCGGATGCGGCATCCTTCATAAATCCTCGAGGATTTATGAAGGATGCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178671.3-1094s21c1
Sequence:CCGGCCAAAGGTTCGTGCGCTATTTCTCGAGAAATAGCGCACGAACCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178671.3-925s1c1
Sequence:CCGGCCCTTTACCAAGAGGATTCAACTCGAGTTGAATCCTCTTGGTAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178671.3-569s21c1
Sequence:CCGGCTCACTCAGGATGCACGTTATCTCGAGATAACGTGCATCCTGAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178671.3-2119s21c1
Sequence:CCGGCCTACTTGAGCACAGGTAAATCTCGAGATTTACCTGTGCTCAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178671.3-925s21c1
Sequence:CCGGCCCTTTACCAAGAGGATTCAACTCGAGTTGAATCCTCTTGGTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178671
UBXN10 MISSION shRNA Lentiviral Transduction Particles
UBX domain protein 10
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178671.2-977s1c1
Sequence:CCGGCTTAGAGAAGAAGTTCATCATCTCGAGATGATGAACTTCTTCTCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178671.3-1250s21c1
Sequence:CCGGATGCGGCATCCTTCATAAATCCTCGAGGATTTATGAAGGATGCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178671.3-1094s21c1
Sequence:CCGGCCAAAGGTTCGTGCGCTATTTCTCGAGAAATAGCGCACGAACCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178671.3-925s1c1
Sequence:CCGGCCCTTTACCAAGAGGATTCAACTCGAGTTGAATCCTCTTGGTAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178671.3-569s21c1
Sequence:CCGGCTCACTCAGGATGCACGTTATCTCGAGATAACGTGCATCCTGAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178671.3-2119s21c1
Sequence:CCGGCCTACTTGAGCACAGGTAAATCTCGAGATTTACCTGTGCTCAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178671.3-925s21c1
Sequence:CCGGCCCTTTACCAAGAGGATTCAACTCGAGTTGAATCCTCTTGGTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks