EMAIL THIS PAGE TO A FRIEND

UBXN11

UBX domain protein 11

Synonyms: COA-1 SOC SOCI UBXD5
Gene ID:
Human(91544) Summary: This gene encodes a protein with a divergent C-terminal UBX domain. The homologous protein in the rat interacts with members of the Rnd subfamily of Rho GTPases at the cell periphery through its C-terminal region. It also interacts with several heterotrimeric G proteins through their G-alpha subunits and promotes Rho GTPase activation. It is proposed to serve a bidirectional role in the promotion and inhibition of Rho activity through upstream signaling pathways. The 3' coding sequence of this gene contains a polymoprhic region of 24 nt tandem repeats. Several transcripts containing between 1.5 and five repeat units have been reported. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(67586) UBX domain protein 11
Rat(192207) UBX domain protein 11
chicken(419546) UBX domain protein 11
dog(487356) UBX domain protein 11
domestic cat(101101238) UBX domain protein 11
cow(515112) UBX domain protein 11
sheep(101116293) UBX domain protein 11
naked mole-rat(101709741) UBX domain protein 11
domestic guinea pig(100715986) UBX domain protein 11
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183008 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_183008 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_183008 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026257 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026257 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026257 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU133261 MISSION® esiRNA esiRNA human UBXN11 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077262 Rosetta Predictions human pricing
NM_145345 Rosetta Predictions human pricing
NM_183008 Rosetta Predictions human pricing
NM_138853 Rosetta Predictions rat pricing
NM_026257 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077262 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312324 predicted 907
2 SASI_Hs02_00312325 predicted 640
3 SASI_Hs02_00312326 predicted 1000
4 SASI_Hs02_00312327 predicted 976
5 SASI_Hs02_00312328 predicted 566
6 SASI_Hs02_00312329 predicted 638
7 SASI_Hs02_00312330 predicted 972
8 SASI_Hs02_00312331 predicted 585
9 SASI_Hs02_00312332 predicted 565
10 SASI_Hs02_00312333 predicted 587
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145345 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365241 predicted 1388
2 SASI_Hs01_00246042 predicted 1117
3 SASI_Hs02_00365242 predicted 1481
4 SASI_Hs02_00365243 predicted 1460
5 SASI_Hs01_00246045 predicted 1049
6 SASI_Hs01_00246047 predicted 1115
7 SASI_Hs02_00365244 predicted 1451
8 SASI_Hs02_00365245 predicted 1062
9 SASI_Hs02_00365246 predicted 1054
10 SASI_Hs02_00365247 predicted 1071
11 SASI_Hs01_00246040 predicted 674
12 SASI_Hs01_00246041 predicted 698
13 SASI_Hs01_00246043 predicted 592
14 SASI_Hs01_00246044 predicted 398
15 SASI_Hs01_00246046 predicted 688
16 SASI_Hs01_00246048 predicted 729
17 SASI_Hs01_00246049 predicted 488
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183008 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371171 predicted 1391
2 SASI_Hs01_00164780 predicted 1121
3 SASI_Hs02_00371172 predicted 1483
4 SASI_Hs02_00371173 predicted 1467
5 SASI_Hs01_00164783 predicted 1054
6 SASI_Hs01_00164785 predicted 1120
7 SASI_Hs02_00371174 predicted 1450
8 SASI_Hs02_00371175 predicted 1068
9 SASI_Hs02_00371176 predicted 1057
10 SASI_Hs02_00371177 predicted 1079
11 SASI_Hs01_00164778 predicted 915
12 SASI_Hs01_00164779 predicted 934
13 SASI_Hs01_00164781 predicted 834
14 SASI_Hs01_00164782 predicted 644
15 SASI_Hs01_00164784 predicted 923
16 SASI_Hs01_00164786 predicted 972
17 SASI_Hs01_00164787 predicted 722
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138853 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049736 predicted 754
2 SASI_Rn01_00049737 predicted 1077
3 SASI_Rn01_00049738 predicted 832
4 SASI_Rn02_00268247 predicted 530
5 SASI_Rn01_00049739 predicted 1029
6 SASI_Rn01_00049742 predicted 530
7 SASI_Rn01_00049743 predicted 1301
8 SASI_Rn01_00049744 predicted 209
9 SASI_Rn02_00268248 predicted 446
10 SASI_Rn02_00268249 predicted 1121
11 SASI_Rn01_00049740 predicted 1274
12 SASI_Rn01_00049741 predicted 763
13 SASI_Rn01_00049745 predicted 1299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026257 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104109 predicted 856
2 SASI_Mm01_00104110 predicted 980
3 SASI_Mm01_00104111 predicted 682
4 SASI_Mm01_00104112 predicted 777
5 SASI_Mm01_00104113 predicted 495
6 SASI_Mm01_00104114 predicted 219
7 SASI_Mm01_00104115 predicted 466
8 SASI_Mm01_00104116 predicted 1070
9 SASI_Mm01_00104117 predicted 1264
10 SASI_Mm01_00104118 predicted 193
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183008
VALIDATED
UBXN11 MISSION shRNA Bacterial Glycerol Stock
UBX domain protein 11
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183008.2-1695s21c1
Sequence:CCGGCCCGAAGTCCAGCCTGAAATTCTCGAGAATTTCAGGCTGGACTTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183008.2-561s21c1
Sequence:CCGGGATACTGTCCAAGGATCAGAACTCGAGTTCTGATCCTTGGACAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183008.2-1612s21c1
Sequence:CCGGACCCTCTACCAGGACGATACACTCGAGTGTATCGTCCTGGTAGAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183008.1-1194s1c1
Sequence:CCGGCCAGGATGACTGCTGAGAAATCTCGAGATTTCTCAGCAGTCATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183008.1-323s1c1
Sequence:CCGGGAGGTGGACATGTTGAGTGATCTCGAGATCACTCAACATGTCCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_183008.1-1521s1c1
Sequence:CCGGCCTCTGCCTTTGAGATCTTCACTCGAGTGAAGATCTCAAAGGCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183008.1-1004s1c1
Sequence:CCGGGACATATTGGATGGCTTCTTTCTCGAGAAAGAAGCCATCCAATATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183008
VALIDATED
UBXN11 MISSION shRNA shRNA Plasmid DNA
UBX domain protein 11
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183008.2-1695s21c1
Sequence:CCGGCCCGAAGTCCAGCCTGAAATTCTCGAGAATTTCAGGCTGGACTTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183008.2-561s21c1
Sequence:CCGGGATACTGTCCAAGGATCAGAACTCGAGTTCTGATCCTTGGACAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183008.2-1612s21c1
Sequence:CCGGACCCTCTACCAGGACGATACACTCGAGTGTATCGTCCTGGTAGAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183008.1-1194s1c1
Sequence:CCGGCCAGGATGACTGCTGAGAAATCTCGAGATTTCTCAGCAGTCATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183008.1-323s1c1
Sequence:CCGGGAGGTGGACATGTTGAGTGATCTCGAGATCACTCAACATGTCCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_183008.1-1521s1c1
Sequence:CCGGCCTCTGCCTTTGAGATCTTCACTCGAGTGAAGATCTCAAAGGCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183008.1-1004s1c1
Sequence:CCGGGACATATTGGATGGCTTCTTTCTCGAGAAAGAAGCCATCCAATATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183008
VALIDATED
UBXN11 MISSION shRNA Lentiviral Transduction Particles
UBX domain protein 11
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183008.2-1695s21c1
Sequence:CCGGCCCGAAGTCCAGCCTGAAATTCTCGAGAATTTCAGGCTGGACTTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183008.2-561s21c1
Sequence:CCGGGATACTGTCCAAGGATCAGAACTCGAGTTCTGATCCTTGGACAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183008.2-1612s21c1
Sequence:CCGGACCCTCTACCAGGACGATACACTCGAGTGTATCGTCCTGGTAGAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183008.1-1194s1c1
Sequence:CCGGCCAGGATGACTGCTGAGAAATCTCGAGATTTCTCAGCAGTCATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183008.1-323s1c1
Sequence:CCGGGAGGTGGACATGTTGAGTGATCTCGAGATCACTCAACATGTCCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_183008.1-1521s1c1
Sequence:CCGGCCTCTGCCTTTGAGATCTTCACTCGAGTGAAGATCTCAAAGGCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183008.1-1004s1c1
Sequence:CCGGGACATATTGGATGGCTTCTTTCTCGAGAAAGAAGCCATCCAATATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026257
UBXN11 MISSION shRNA Bacterial Glycerol Stock
UBX domain protein 11
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000415868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026257.2-508s21c1
Sequence:CCGGAGCGGTTTCTCAGCGACTATGCTCGAGCATAGTCGCTGAGAAACCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026257.2-1413s21c1
Sequence:CCGGACGGTCTACCAGGACGATACACTCGAGTGTATCGTCCTGGTAGACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026257.1-1086s1c1
Sequence:CCGGCCCAAGTGTATAATCCGACAACTCGAGTTGTCGGATTATACACTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026257.1-1051s1c1
Sequence:CCGGCCAGGATGACTGCTGAACAATCTCGAGATTGTTCAGCAGTCATCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026257.1-160s1c1
Sequence:CCGGGAGGGATAAGAGTCTACGGAACTCGAGTTCCGTAGACTCTTATCCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026257.1-212s1c1
Sequence:CCGGCCAAGACTCAGAAGAGAAGATCTCGAGATCTTCTCTTCTGAGTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026257.1-789s1c1
Sequence:CCGGCGGAATGGCATTATGATGTTTCTCGAGAAACATCATAATGCCATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026257
UBXN11 MISSION shRNA shRNA Plasmid DNA
UBX domain protein 11
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000415868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026257.2-508s21c1
Sequence:CCGGAGCGGTTTCTCAGCGACTATGCTCGAGCATAGTCGCTGAGAAACCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026257.2-1413s21c1
Sequence:CCGGACGGTCTACCAGGACGATACACTCGAGTGTATCGTCCTGGTAGACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026257.1-1086s1c1
Sequence:CCGGCCCAAGTGTATAATCCGACAACTCGAGTTGTCGGATTATACACTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026257.1-1051s1c1
Sequence:CCGGCCAGGATGACTGCTGAACAATCTCGAGATTGTTCAGCAGTCATCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026257.1-160s1c1
Sequence:CCGGGAGGGATAAGAGTCTACGGAACTCGAGTTCCGTAGACTCTTATCCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026257.1-212s1c1
Sequence:CCGGCCAAGACTCAGAAGAGAAGATCTCGAGATCTTCTCTTCTGAGTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026257.1-789s1c1
Sequence:CCGGCGGAATGGCATTATGATGTTTCTCGAGAAACATCATAATGCCATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026257
UBXN11 MISSION shRNA Lentiviral Transduction Particles
UBX domain protein 11
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000415868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026257.2-508s21c1
Sequence:CCGGAGCGGTTTCTCAGCGACTATGCTCGAGCATAGTCGCTGAGAAACCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026257.2-1413s21c1
Sequence:CCGGACGGTCTACCAGGACGATACACTCGAGTGTATCGTCCTGGTAGACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026257.1-1086s1c1
Sequence:CCGGCCCAAGTGTATAATCCGACAACTCGAGTTGTCGGATTATACACTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026257.1-1051s1c1
Sequence:CCGGCCAGGATGACTGCTGAACAATCTCGAGATTGTTCAGCAGTCATCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026257.1-160s1c1
Sequence:CCGGGAGGGATAAGAGTCTACGGAACTCGAGTTCCGTAGACTCTTATCCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026257.1-212s1c1
Sequence:CCGGCCAAGACTCAGAAGAGAAGATCTCGAGATCTTCTCTTCTGAGTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026257.1-789s1c1
Sequence:CCGGCGGAATGGCATTATGATGTTTCTCGAGAAACATCATAATGCCATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks