EMAIL THIS PAGE TO A FRIEND

UBXN1

UBX domain protein 1

Synonyms: 2B28 SAKS1 UBXD10
UniProtKB ID: Q04323, Q9BV93, Q9BVV5
Gene ID:
Mouse(225896) UBX domain protein 1
Rat(293719) UBX domain protein 1
Zebrafish(322073) UBX domain protein 1
dog(476055) UBX domain protein 1
domestic cat(101090896) UBX domain protein 1
cow(506676) UBX domain protein 1
sheep(101113110) UBX domain protein 1
Goat(100861113) UBX domain protein 1
naked mole-rat(101724463) UBX domain protein 1
domestic guinea pig(100730541) UBX domain protein 1
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2105054 Anti-LOC51035 antibody produced in rabbit affinity isolated antibody guinea pig, horse, human, mouse, rabbit
western blot pricing
SAB1407434 Anti-UBXN1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA012669 Anti-UBXN1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2702122 Anti-UBXN1 antibody produced in rabbit human, mouse
immunocytochemistry, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015853 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015853 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015853 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146093 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146093 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146093 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015853 Rosetta Predictions human pricing
NM_001034829 Rosetta Predictions rat pricing
NM_146093 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015853 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134629 predicted 263
2 SASI_Hs01_00134631 predicted 975
3 SASI_Hs01_00134632 predicted 371
4 SASI_Hs01_00134633 predicted 376
5 SASI_Hs01_00134635 predicted 435
6 SASI_Hs01_00134636 predicted 654
7 SASI_Hs01_00134637 predicted 352
8 SASI_Hs01_00134638 predicted 808
9 SASI_Hs02_00348441 predicted 397
10 SASI_Hs02_00348442 predicted 376
11 SASI_Hs01_00134630 predicted 398
12 SASI_Hs01_00134634 predicted 395
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034829 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107379 predicted 340
2 SASI_Rn01_00107380 predicted 271
3 SASI_Rn01_00107381 predicted 272
4 SASI_Rn01_00107383 predicted 465
5 SASI_Rn02_00204034 predicted 452
6 SASI_Rn01_00107384 predicted 333
7 SASI_Rn01_00107385 predicted 633
8 SASI_Rn01_00107387 predicted 629
9 SASI_Rn01_00107388 predicted 409
10 SASI_Rn02_00204035 predicted 380
11 SASI_Rn01_00107382 predicted 282
12 SASI_Rn01_00107386 predicted 414
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146093 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078123 predicted 436
2 SASI_Mm01_00078124 predicted 587
3 SASI_Mm01_00078125 predicted 514
4 SASI_Mm02_00341731 predicted 767
5 SASI_Mm01_00078126 predicted 332
6 SASI_Mm01_00078127 predicted 529
7 SASI_Mm02_00341732 predicted 758
8 SASI_Mm01_00078128 predicted 344
9 SASI_Mm01_00078129 predicted 669
10 SASI_Mm01_00078130 predicted 736
11 SASI_Mm01_00078131 predicted 584
12 SASI_Mm01_00078132 predicted 681
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015853
UBXN1 MISSION shRNA Bacterial Glycerol Stock
UBX domain protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000335802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015853.3-600s21c1
Sequence:CCGGGGAGTTAGCAGCCAGACAAAGCTCGAGCTTTGTCTGGCTGCTAACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335803    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015853.3-1074s21c1
Sequence:CCGGATGGTGCAAGGCCAGGAATTTCTCGAGAAATTCCTGGCCTTGCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015853.3-978s21c1
Sequence:CCGGTATGGCTGCAAGACTAGAAACCTCGAGGTTTCTAGTCTTGCAGCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015853.3-396s21c1
Sequence:CCGGAGAGGAAAGACAGGAACAAACCTCGAGGTTTGTTCCTGTCTTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015853.3-763s21c1
Sequence:CCGGTATGACCAGTGTCGCATACAGCTCGAGCTGTATGCGACACTGGTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015853.x-268s1c1
Sequence:CCGGCCCGATGTGGACGAGCCTTTACTCGAGTAAAGGCTCGTCCACATCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015853.x-610s1c1
Sequence:CCGGGCCAGACAAAGAGTTAGAGAACTCGAGTTCTCTAACTCTTTGTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004112    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015853.x-1247s1c1
Sequence:CCGGGCACTGACATCTCCTTCCTAACTCGAGTTAGGAAGGAGATGTCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015853.x-977s1c1
Sequence:CCGGGTATGGCTGCAAGACTAGAAACTCGAGTTTCTAGTCTTGCAGCCATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015853.x-599s1c1
Sequence:CCGGAGGAGTTAGCAGCCAGACAAACTCGAGTTTGTCTGGCTGCTAACTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015853
UBXN1 MISSION shRNA shRNA Plasmid DNA
UBX domain protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000335802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015853.3-600s21c1
Sequence:CCGGGGAGTTAGCAGCCAGACAAAGCTCGAGCTTTGTCTGGCTGCTAACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335803    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015853.3-1074s21c1
Sequence:CCGGATGGTGCAAGGCCAGGAATTTCTCGAGAAATTCCTGGCCTTGCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015853.3-978s21c1
Sequence:CCGGTATGGCTGCAAGACTAGAAACCTCGAGGTTTCTAGTCTTGCAGCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015853.3-396s21c1
Sequence:CCGGAGAGGAAAGACAGGAACAAACCTCGAGGTTTGTTCCTGTCTTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015853.3-763s21c1
Sequence:CCGGTATGACCAGTGTCGCATACAGCTCGAGCTGTATGCGACACTGGTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015853.x-268s1c1
Sequence:CCGGCCCGATGTGGACGAGCCTTTACTCGAGTAAAGGCTCGTCCACATCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015853.x-610s1c1
Sequence:CCGGGCCAGACAAAGAGTTAGAGAACTCGAGTTCTCTAACTCTTTGTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004112    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015853.x-1247s1c1
Sequence:CCGGGCACTGACATCTCCTTCCTAACTCGAGTTAGGAAGGAGATGTCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015853.x-977s1c1
Sequence:CCGGGTATGGCTGCAAGACTAGAAACTCGAGTTTCTAGTCTTGCAGCCATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015853.x-599s1c1
Sequence:CCGGAGGAGTTAGCAGCCAGACAAACTCGAGTTTGTCTGGCTGCTAACTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015853
UBXN1 MISSION shRNA Lentiviral Transduction Particles
UBX domain protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000335802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015853.3-600s21c1
Sequence:CCGGGGAGTTAGCAGCCAGACAAAGCTCGAGCTTTGTCTGGCTGCTAACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335803    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015853.3-1074s21c1
Sequence:CCGGATGGTGCAAGGCCAGGAATTTCTCGAGAAATTCCTGGCCTTGCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015853.3-978s21c1
Sequence:CCGGTATGGCTGCAAGACTAGAAACCTCGAGGTTTCTAGTCTTGCAGCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015853.3-396s21c1
Sequence:CCGGAGAGGAAAGACAGGAACAAACCTCGAGGTTTGTTCCTGTCTTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015853.3-763s21c1
Sequence:CCGGTATGACCAGTGTCGCATACAGCTCGAGCTGTATGCGACACTGGTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015853.x-268s1c1
Sequence:CCGGCCCGATGTGGACGAGCCTTTACTCGAGTAAAGGCTCGTCCACATCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015853.x-610s1c1
Sequence:CCGGGCCAGACAAAGAGTTAGAGAACTCGAGTTCTCTAACTCTTTGTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004112    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015853.x-1247s1c1
Sequence:CCGGGCACTGACATCTCCTTCCTAACTCGAGTTAGGAAGGAGATGTCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015853.x-977s1c1
Sequence:CCGGGTATGGCTGCAAGACTAGAAACTCGAGTTTCTAGTCTTGCAGCCATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015853.x-599s1c1
Sequence:CCGGAGGAGTTAGCAGCCAGACAAACTCGAGTTTGTCTGGCTGCTAACTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146093
VALIDATED
UBXN1 MISSION shRNA Bacterial Glycerol Stock
UBX domain protein 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000302353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146093.1-533s21c1
Sequence:CCGGCCAGACAAAGGGTTCGAGAAACTCGAGTTTCTCGAACCCTTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146093.1-347s21c1
Sequence:CCGGTGTTGGAACTTGTGGCACAAACTCGAGTTTGTGCCACAAGTTCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146093.1-398s21c1
Sequence:CCGGGAGAAGCTTTAGAACGAGAAACTCGAGTTTCTCGTTCTAAAGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146093.1-682s21c1
Sequence:CCGGGAGTATGACCAGTGTCGTATACTCGAGTATACGACACTGGTCATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146093.1-682s1c1
Sequence:CCGGGAGTATGACCAGTGTCGTATACTCGAGTATACGACACTGGTCATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146093.1-398s1c1
Sequence:CCGGGAGAAGCTTTAGAACGAGAAACTCGAGTTTCTCGTTCTAAAGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146093.1-533s1c1
Sequence:CCGGCCAGACAAAGGGTTCGAGAAACTCGAGTTTCTCGAACCCTTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146093.1-347s1c1
Sequence:CCGGTGTTGGAACTTGTGGCACAAACTCGAGTTTGTGCCACAAGTTCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146093.1-290s1c1
Sequence:CCGGCTGGAGAAAGCAGACCCATTTCTCGAGAAATGGGTCTGCTTTCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146093
VALIDATED
UBXN1 MISSION shRNA shRNA Plasmid DNA
UBX domain protein 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000302353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146093.1-533s21c1
Sequence:CCGGCCAGACAAAGGGTTCGAGAAACTCGAGTTTCTCGAACCCTTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146093.1-347s21c1
Sequence:CCGGTGTTGGAACTTGTGGCACAAACTCGAGTTTGTGCCACAAGTTCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146093.1-398s21c1
Sequence:CCGGGAGAAGCTTTAGAACGAGAAACTCGAGTTTCTCGTTCTAAAGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146093.1-682s21c1
Sequence:CCGGGAGTATGACCAGTGTCGTATACTCGAGTATACGACACTGGTCATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146093.1-682s1c1
Sequence:CCGGGAGTATGACCAGTGTCGTATACTCGAGTATACGACACTGGTCATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146093.1-398s1c1
Sequence:CCGGGAGAAGCTTTAGAACGAGAAACTCGAGTTTCTCGTTCTAAAGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146093.1-533s1c1
Sequence:CCGGCCAGACAAAGGGTTCGAGAAACTCGAGTTTCTCGAACCCTTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146093.1-347s1c1
Sequence:CCGGTGTTGGAACTTGTGGCACAAACTCGAGTTTGTGCCACAAGTTCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146093.1-290s1c1
Sequence:CCGGCTGGAGAAAGCAGACCCATTTCTCGAGAAATGGGTCTGCTTTCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146093
VALIDATED
UBXN1 MISSION shRNA Lentiviral Transduction Particles
UBX domain protein 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000302353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146093.1-533s21c1
Sequence:CCGGCCAGACAAAGGGTTCGAGAAACTCGAGTTTCTCGAACCCTTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146093.1-347s21c1
Sequence:CCGGTGTTGGAACTTGTGGCACAAACTCGAGTTTGTGCCACAAGTTCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146093.1-398s21c1
Sequence:CCGGGAGAAGCTTTAGAACGAGAAACTCGAGTTTCTCGTTCTAAAGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146093.1-682s21c1
Sequence:CCGGGAGTATGACCAGTGTCGTATACTCGAGTATACGACACTGGTCATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146093.1-682s1c1
Sequence:CCGGGAGTATGACCAGTGTCGTATACTCGAGTATACGACACTGGTCATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146093.1-398s1c1
Sequence:CCGGGAGAAGCTTTAGAACGAGAAACTCGAGTTTCTCGTTCTAAAGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146093.1-533s1c1
Sequence:CCGGCCAGACAAAGGGTTCGAGAAACTCGAGTTTCTCGAACCCTTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146093.1-347s1c1
Sequence:CCGGTGTTGGAACTTGTGGCACAAACTCGAGTTTGTGCCACAAGTTCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146093.1-290s1c1
Sequence:CCGGCTGGAGAAAGCAGACCCATTTCTCGAGAAATGGGTCTGCTTTCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks