EMAIL THIS PAGE TO A FRIEND

UBXN2A

UBX domain protein 2A

Synonyms: UBXD4
UniProtKB ID: P68543, A8K577, Q569G8
Gene ID:
Mouse(217379) UBX domain protein 2A
Rat(685859) UBX domain protein 2A
domestic guinea pig(100717847) UBX domain protein 2A
cow(613578) UBX domain protein 2A
sheep(101105733) UBX domain protein 2A
Zebrafish(100537478) UBX domain protein 2A
domestic cat(101096145) UBX domain protein 2A
dog(482992) UBX domain protein 2A
chicken(421973) UBX domain protein 2A
112 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145441 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145441 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145441 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_181713 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181713 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181713 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181713 Rosetta Predictions human pricing
NM_001109482 Rosetta Predictions rat pricing
NM_145441 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181713 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219228 predicted 664
2 SASI_Hs01_00219229 predicted 734
3 SASI_Hs01_00219230 predicted 321
4 SASI_Hs02_00370321 predicted 323
5 SASI_Hs01_00219231 predicted 739
6 SASI_Hs02_00370322 predicted 701
7 SASI_Hs01_00219232 predicted 855
8 SASI_Hs01_00219234 predicted 655
9 SASI_Hs01_00219235 predicted 657
10 SASI_Hs01_00219237 predicted 515
11 SASI_Hs01_00219233 predicted 570
12 SASI_Hs01_00219236 predicted 980
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109482 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248829 predicted 883
2 SASI_Rn02_00248830 predicted 1049
3 SASI_Rn02_00248831 predicted 1113
4 SASI_Rn02_00248832 predicted 982
5 SASI_Rn02_00248833 predicted 1180
6 SASI_Rn02_00248834 predicted 756
7 SASI_Rn02_00248835 predicted 1197
8 SASI_Rn02_00248836 predicted 1001
9 SASI_Rn02_00248837 predicted 1018
10 SASI_Rn02_00248838 predicted 1071
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145441 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340820 predicted 888
2 SASI_Mm02_00340821 predicted 701
3 SASI_Mm02_00340822 predicted 468
4 SASI_Mm01_00063518 predicted 1041
5 SASI_Mm02_00340823 predicted 353
6 SASI_Mm02_00340824 predicted 1028
7 SASI_Mm02_00340825 predicted 734
8 SASI_Mm02_00340826 predicted 629
9 SASI_Mm02_00340827 predicted 685
10 SASI_Mm02_00340828 predicted 617
11 SASI_Mm01_00063519 predicted 607
12 SASI_Mm01_00063520 predicted 597
13 SASI_Mm01_00063521 predicted 202
14 SASI_Mm01_00063522 predicted 200
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145441
VALIDATED
UBXN2A MISSION shRNA Bacterial Glycerol Stock
UBX domain protein 2A
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145441.2-894s1c1
Sequence:CCGGGCAGATTTGAAGAATGCTGTACTCGAGTACAGCATTCTTCAAATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145441.2-846s1c1
Sequence:CCGGGCTCTTCCTTTCCTCAGGTTTCTCGAGAAACCTGAGGAAAGGAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145441.2-687s1c1
Sequence:CCGGCTGAACAACTTGGAGCCCATTCTCGAGAATGGGCTCCAAGTTGTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145441.2-888s1c1
Sequence:CCGGGAAGAAGCAGATTTGAAGAATCTCGAGATTCTTCAAATCTGCTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145441.2-435s1c1
Sequence:CCGGGATGGTGCAAGTCAGCAGTTTCTCGAGAAACTGCTGACTTGCACCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145441.3-686s21c1
Sequence:CCGGCTGAACAACTTGGAGCCCATTCTCGAGAATGGGCTCCAAGTTGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145441.3-434s21c1
Sequence:CCGGGATGGTGCAAGTCAGCAGTTTCTCGAGAAACTGCTGACTTGCACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145441.3-893s21c1
Sequence:CCGGGCAGATTTGAAGAATGCTGTACTCGAGTACAGCATTCTTCAAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145441.3-845s21c1
Sequence:CCGGGCTCTTCCTTTCCTCAGGTTTCTCGAGAAACCTGAGGAAAGGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145441
VALIDATED
UBXN2A MISSION shRNA shRNA Plasmid DNA
UBX domain protein 2A
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145441.2-894s1c1
Sequence:CCGGGCAGATTTGAAGAATGCTGTACTCGAGTACAGCATTCTTCAAATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145441.2-846s1c1
Sequence:CCGGGCTCTTCCTTTCCTCAGGTTTCTCGAGAAACCTGAGGAAAGGAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145441.2-687s1c1
Sequence:CCGGCTGAACAACTTGGAGCCCATTCTCGAGAATGGGCTCCAAGTTGTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145441.2-888s1c1
Sequence:CCGGGAAGAAGCAGATTTGAAGAATCTCGAGATTCTTCAAATCTGCTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145441.2-435s1c1
Sequence:CCGGGATGGTGCAAGTCAGCAGTTTCTCGAGAAACTGCTGACTTGCACCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145441.3-686s21c1
Sequence:CCGGCTGAACAACTTGGAGCCCATTCTCGAGAATGGGCTCCAAGTTGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145441.3-434s21c1
Sequence:CCGGGATGGTGCAAGTCAGCAGTTTCTCGAGAAACTGCTGACTTGCACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145441.3-893s21c1
Sequence:CCGGGCAGATTTGAAGAATGCTGTACTCGAGTACAGCATTCTTCAAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145441.3-845s21c1
Sequence:CCGGGCTCTTCCTTTCCTCAGGTTTCTCGAGAAACCTGAGGAAAGGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145441
VALIDATED
UBXN2A MISSION shRNA Lentiviral Transduction Particles
UBX domain protein 2A
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145441.2-894s1c1
Sequence:CCGGGCAGATTTGAAGAATGCTGTACTCGAGTACAGCATTCTTCAAATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145441.2-846s1c1
Sequence:CCGGGCTCTTCCTTTCCTCAGGTTTCTCGAGAAACCTGAGGAAAGGAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145441.2-687s1c1
Sequence:CCGGCTGAACAACTTGGAGCCCATTCTCGAGAATGGGCTCCAAGTTGTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145441.2-888s1c1
Sequence:CCGGGAAGAAGCAGATTTGAAGAATCTCGAGATTCTTCAAATCTGCTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145441.2-435s1c1
Sequence:CCGGGATGGTGCAAGTCAGCAGTTTCTCGAGAAACTGCTGACTTGCACCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145441.3-686s21c1
Sequence:CCGGCTGAACAACTTGGAGCCCATTCTCGAGAATGGGCTCCAAGTTGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145441.3-434s21c1
Sequence:CCGGGATGGTGCAAGTCAGCAGTTTCTCGAGAAACTGCTGACTTGCACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145441.3-893s21c1
Sequence:CCGGGCAGATTTGAAGAATGCTGTACTCGAGTACAGCATTCTTCAAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145441.3-845s21c1
Sequence:CCGGGCTCTTCCTTTCCTCAGGTTTCTCGAGAAACCTGAGGAAAGGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181713
UBXN2A MISSION shRNA Bacterial Glycerol Stock
UBX domain protein 2A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181713.3-1274s1c1
Sequence:CCGGCCCAGACAGCAGGGATTTATTCTCGAGAATAAATCCCTGCTGTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181713.3-656s1c1
Sequence:CCGGCTGAACAACTTGGAACCCATTCTCGAGAATGGGTTCCAAGTTGTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181713.3-881s1c1
Sequence:CCGGGTCATCATTCAGAGACTCCAACTCGAGTTGGAGTCTCTGAATGATGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181713.3-287s1c1
Sequence:CCGGGCTCAGAAGGTTAGTTCCAAACTCGAGTTTGGAACTAACCTTCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181713.3-227s1c1
Sequence:CCGGCCTCTTGGTAATAATCAACAACTCGAGTTGTTGATTATTACCAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181713.3-478s21c1
Sequence:CCGGTAAAGAAGAGGTGGACGTTAACTCGAGTTAACGTCCACCTCTTCTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181713.3-370s21c1
Sequence:CCGGATTCACCGTCAACGACGATTTCTCGAGAAATCGTCGTTGACGGTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181713.3-202s21c1
Sequence:CCGGTTGTGAAACAGGATCTGATAACTCGAGTTATCAGATCCTGTTTCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181713
UBXN2A MISSION shRNA shRNA Plasmid DNA
UBX domain protein 2A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181713.3-1274s1c1
Sequence:CCGGCCCAGACAGCAGGGATTTATTCTCGAGAATAAATCCCTGCTGTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181713.3-656s1c1
Sequence:CCGGCTGAACAACTTGGAACCCATTCTCGAGAATGGGTTCCAAGTTGTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181713.3-881s1c1
Sequence:CCGGGTCATCATTCAGAGACTCCAACTCGAGTTGGAGTCTCTGAATGATGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181713.3-287s1c1
Sequence:CCGGGCTCAGAAGGTTAGTTCCAAACTCGAGTTTGGAACTAACCTTCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181713.3-227s1c1
Sequence:CCGGCCTCTTGGTAATAATCAACAACTCGAGTTGTTGATTATTACCAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181713.3-478s21c1
Sequence:CCGGTAAAGAAGAGGTGGACGTTAACTCGAGTTAACGTCCACCTCTTCTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181713.3-370s21c1
Sequence:CCGGATTCACCGTCAACGACGATTTCTCGAGAAATCGTCGTTGACGGTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181713.3-202s21c1
Sequence:CCGGTTGTGAAACAGGATCTGATAACTCGAGTTATCAGATCCTGTTTCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181713
UBXN2A MISSION shRNA Lentiviral Transduction Particles
UBX domain protein 2A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181713.3-1274s1c1
Sequence:CCGGCCCAGACAGCAGGGATTTATTCTCGAGAATAAATCCCTGCTGTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181713.3-656s1c1
Sequence:CCGGCTGAACAACTTGGAACCCATTCTCGAGAATGGGTTCCAAGTTGTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181713.3-881s1c1
Sequence:CCGGGTCATCATTCAGAGACTCCAACTCGAGTTGGAGTCTCTGAATGATGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181713.3-287s1c1
Sequence:CCGGGCTCAGAAGGTTAGTTCCAAACTCGAGTTTGGAACTAACCTTCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181713.3-227s1c1
Sequence:CCGGCCTCTTGGTAATAATCAACAACTCGAGTTGTTGATTATTACCAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181713.3-478s21c1
Sequence:CCGGTAAAGAAGAGGTGGACGTTAACTCGAGTTAACGTCCACCTCTTCTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181713.3-370s21c1
Sequence:CCGGATTCACCGTCAACGACGATTTCTCGAGAAATCGTCGTTGACGGTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181713.3-202s21c1
Sequence:CCGGTTGTGAAACAGGATCTGATAACTCGAGTTATCAGATCCTGTTTCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks