EMAIL THIS PAGE TO A FRIEND

UBXN2B

UBX domain protein 2B

Synonyms: p37
UniProtKB ID: Q14CS0, B3KWZ3
Gene ID:
Mouse(68053) UBX domain protein 2B
Rat(312965) UBX domain protein 2B
chicken(421135) UBX domain protein 2B
domestic cat(101099354) UBX domain protein 2B
dog(477891) UBX domain protein 2B
cow(530316) UBX domain protein 2B
sheep(101109812) UBX domain protein 2B
domestic guinea pig(100721861) UBX domain protein 2B
naked mole-rat(101702037) UBX domain protein 2B
86 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001077619 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001077619 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001077619 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026534 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026534 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026534 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU069791 MISSION® esiRNA esiRNA targeting mouse Ubxn2b (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077619 Rosetta Predictions human pricing
XM_059929 Rosetta Predictions human pricing
XM_933088 Rosetta Predictions human pricing
XM_933092 Rosetta Predictions human pricing
XM_933097 Rosetta Predictions human pricing
NM_001107905 Rosetta Predictions rat pricing
NM_026534 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077619 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312994 predicted 454
2 SASI_Hs02_00312995 predicted 914
3 SASI_Hs02_00312996 predicted 741
4 SASI_Hs02_00312997 predicted 505
5 SASI_Hs02_00312998 predicted 629
6 SASI_Hs02_00312999 predicted 326
7 SASI_Hs02_00313000 predicted 236
8 SASI_Hs02_00313001 predicted 805
9 SASI_Hs02_00313002 predicted 426
10 SASI_Hs02_00313003 predicted 232
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_059929 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00270106 predicted 380
2 SASI_Hs01_00270107 predicted 837
3 SASI_Hs01_00270108 predicted 428
4 SASI_Hs01_00270109 predicted 548
5 SASI_Hs01_00270110 predicted 242
6 SASI_Hs01_00270111 predicted 526
7 SASI_Hs01_00270112 predicted 632
8 SASI_Hs01_00270113 predicted 725
9 SASI_Hs01_00270114 predicted 353
10 SASI_Hs01_00270115 predicted 768
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933088 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00256998 predicted 681
2 SASI_Hs01_00256999 predicted 681
3 SASI_Hs01_00257000 predicted 686
4 SASI_Hs01_00257001 predicted 679
5 SASI_Hs01_00257002 predicted 686
6 SASI_Hs01_00257003 predicted 682
7 SASI_Hs01_00257004 predicted 686
8 SASI_Hs01_00257005 predicted 681
9 SASI_Hs01_00257006 predicted 685
10 SASI_Hs01_00257007 predicted 880
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933092 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00250745 predicted 364
2 SASI_Hs01_00250746 predicted 398
3 SASI_Hs01_00250747 predicted 485
4 SASI_Hs01_00250748 predicted 429
5 SASI_Hs01_00250749 predicted 376
6 SASI_Hs01_00250750 predicted 518
7 SASI_Hs01_00250751 predicted 541
8 SASI_Hs01_00250752 predicted 243
9 SASI_Hs01_00250753 predicted 522
10 SASI_Hs01_00250754 predicted 520
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933097 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00249515 predicted 386
2 SASI_Hs01_00249516 predicted 578
3 SASI_Hs01_00249517 predicted 485
4 SASI_Hs01_00249518 predicted 422
5 SASI_Hs01_00249519 predicted 543
6 SASI_Hs01_00249520 predicted 249
7 SASI_Hs01_00249521 predicted 523
8 SASI_Hs01_00249522 predicted 274
9 SASI_Hs01_00249523 predicted 345
10 SASI_Hs01_00249524 predicted 394
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107905 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233435 predicted 820
2 SASI_Rn02_00233436 predicted 907
3 SASI_Rn02_00233437 predicted 646
4 SASI_Rn02_00233438 predicted 752
5 SASI_Rn02_00233439 predicted 969
6 SASI_Rn02_00233440 predicted 328
7 SASI_Rn02_00233441 predicted 944
8 SASI_Rn02_00233442 predicted 237
9 SASI_Rn02_00233443 predicted 358
10 SASI_Rn02_00233444 predicted 823
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026534 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098989 predicted 365
2 SASI_Mm01_00098990 predicted 910
3 SASI_Mm01_00098991 predicted 204
4 SASI_Mm01_00098992 predicted 988
5 SASI_Mm01_00098993 predicted 207
6 SASI_Mm01_00098994 predicted 506
7 SASI_Mm02_00330460 predicted 984
8 SASI_Mm01_00098995 predicted 499
9 SASI_Mm01_00098996 predicted 850
10 SASI_Mm01_00098997 predicted 892
11 SASI_Mm01_00098988 predicted 755
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001077619
VALIDATED
UBXN2B MISSION shRNA Bacterial Glycerol Stock
UBX domain protein 2B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_001077619.1-615s21c1
Sequence:CCGGGAACCAACAAATGCTCAATTTCTCGAGAAATTGAGCATTTGTTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001077619.1-245s21c1
Sequence:CCGGCAAATCTTCCAAGTCTAATAGCTCGAGCTATTAGACTTGGAAGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253703    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001077619.1-1151s21c1
Sequence:CCGGATAGATGATGTGCCGTATTAACTCGAGTTAATACGGCACATCATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001077619.1-1023s21c1
Sequence:CCGGGTGACTTCATTTCCGAATAAACTCGAGTTTATTCGGAAATGAAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001077619.1-326s21c1
Sequence:CCGGACATGAATACAGTGGATTAAACTCGAGTTTAATCCACTGTATTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001077619
VALIDATED
UBXN2B MISSION shRNA shRNA Plasmid DNA
UBX domain protein 2B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_001077619.1-615s21c1
Sequence:CCGGGAACCAACAAATGCTCAATTTCTCGAGAAATTGAGCATTTGTTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001077619.1-245s21c1
Sequence:CCGGCAAATCTTCCAAGTCTAATAGCTCGAGCTATTAGACTTGGAAGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253703    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001077619.1-1151s21c1
Sequence:CCGGATAGATGATGTGCCGTATTAACTCGAGTTAATACGGCACATCATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001077619.1-1023s21c1
Sequence:CCGGGTGACTTCATTTCCGAATAAACTCGAGTTTATTCGGAAATGAAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001077619.1-326s21c1
Sequence:CCGGACATGAATACAGTGGATTAAACTCGAGTTTAATCCACTGTATTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001077619
VALIDATED
UBXN2B MISSION shRNA Lentiviral Transduction Particles
UBX domain protein 2B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_001077619.1-615s21c1
Sequence:CCGGGAACCAACAAATGCTCAATTTCTCGAGAAATTGAGCATTTGTTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001077619.1-245s21c1
Sequence:CCGGCAAATCTTCCAAGTCTAATAGCTCGAGCTATTAGACTTGGAAGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253703    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001077619.1-1151s21c1
Sequence:CCGGATAGATGATGTGCCGTATTAACTCGAGTTAATACGGCACATCATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001077619.1-1023s21c1
Sequence:CCGGGTGACTTCATTTCCGAATAAACTCGAGTTTATTCGGAAATGAAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001077619.1-326s21c1
Sequence:CCGGACATGAATACAGTGGATTAAACTCGAGTTTAATCCACTGTATTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026534
VALIDATED
UBXN2B MISSION shRNA Bacterial Glycerol Stock
UBX domain protein 2B
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000279083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026534.2-209s21c1
Sequence:CCGGCATCGGCTTTATTCAGGTGATCTCGAGATCACCTGAATAAAGCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026534.2-827s21c1
Sequence:CCGGCGTCTCGTACAGAGATTCAATCTCGAGATTGAATCTCTGTACGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026534.2-938s21c1
Sequence:CCGGCCAAGTAAAGAACTAACAGATCTCGAGATCTGTTAGTTCTTTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026534.2-905s21c1
Sequence:CCGGGCGACTACTGACTTTATTCTTCTCGAGAAGAATAAAGTCAGTAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026534.2-761s21c1
Sequence:CCGGGCAGCTGTTCTTATTGATGATCTCGAGATCATCAATAAGAACAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026534.1-937s1c1
Sequence:CCGGCCAAGTAAAGAACTAACAGATCTCGAGATCTGTTAGTTCTTTACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026534.1-904s1c1
Sequence:CCGGGCGACTACTGACTTTATTCTTCTCGAGAAGAATAAAGTCAGTAGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026534.1-760s1c1
Sequence:CCGGGCAGCTGTTCTTATTGATGATCTCGAGATCATCAATAAGAACAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026534.1-208s1c1
Sequence:CCGGCATCGGCTTTATTCAGGTGATCTCGAGATCACCTGAATAAAGCCGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026534.1-826s1c1
Sequence:CCGGCGTCTCGTACAGAGATTCAATCTCGAGATTGAATCTCTGTACGAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026534
VALIDATED
UBXN2B MISSION shRNA shRNA Plasmid DNA
UBX domain protein 2B
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000279083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026534.2-209s21c1
Sequence:CCGGCATCGGCTTTATTCAGGTGATCTCGAGATCACCTGAATAAAGCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026534.2-827s21c1
Sequence:CCGGCGTCTCGTACAGAGATTCAATCTCGAGATTGAATCTCTGTACGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026534.2-938s21c1
Sequence:CCGGCCAAGTAAAGAACTAACAGATCTCGAGATCTGTTAGTTCTTTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026534.2-905s21c1
Sequence:CCGGGCGACTACTGACTTTATTCTTCTCGAGAAGAATAAAGTCAGTAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026534.2-761s21c1
Sequence:CCGGGCAGCTGTTCTTATTGATGATCTCGAGATCATCAATAAGAACAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026534.1-937s1c1
Sequence:CCGGCCAAGTAAAGAACTAACAGATCTCGAGATCTGTTAGTTCTTTACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026534.1-904s1c1
Sequence:CCGGGCGACTACTGACTTTATTCTTCTCGAGAAGAATAAAGTCAGTAGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026534.1-760s1c1
Sequence:CCGGGCAGCTGTTCTTATTGATGATCTCGAGATCATCAATAAGAACAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026534.1-208s1c1
Sequence:CCGGCATCGGCTTTATTCAGGTGATCTCGAGATCACCTGAATAAAGCCGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026534.1-826s1c1
Sequence:CCGGCGTCTCGTACAGAGATTCAATCTCGAGATTGAATCTCTGTACGAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026534
VALIDATED
UBXN2B MISSION shRNA Lentiviral Transduction Particles
UBX domain protein 2B
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000279083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026534.2-209s21c1
Sequence:CCGGCATCGGCTTTATTCAGGTGATCTCGAGATCACCTGAATAAAGCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026534.2-827s21c1
Sequence:CCGGCGTCTCGTACAGAGATTCAATCTCGAGATTGAATCTCTGTACGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026534.2-938s21c1
Sequence:CCGGCCAAGTAAAGAACTAACAGATCTCGAGATCTGTTAGTTCTTTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026534.2-905s21c1
Sequence:CCGGGCGACTACTGACTTTATTCTTCTCGAGAAGAATAAAGTCAGTAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026534.2-761s21c1
Sequence:CCGGGCAGCTGTTCTTATTGATGATCTCGAGATCATCAATAAGAACAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026534.1-937s1c1
Sequence:CCGGCCAAGTAAAGAACTAACAGATCTCGAGATCTGTTAGTTCTTTACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026534.1-904s1c1
Sequence:CCGGGCGACTACTGACTTTATTCTTCTCGAGAAGAATAAAGTCAGTAGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026534.1-760s1c1
Sequence:CCGGGCAGCTGTTCTTATTGATGATCTCGAGATCATCAATAAGAACAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026534.1-208s1c1
Sequence:CCGGCATCGGCTTTATTCAGGTGATCTCGAGATCACCTGAATAAAGCCGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026534.1-826s1c1
Sequence:CCGGCGTCTCGTACAGAGATTCAATCTCGAGATTGAATCTCTGTACGAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks