EMAIL THIS PAGE TO A FRIEND

UBXN4

UBX domain protein 4

Synonyms: UBXD2 UBXDC1 erasin
UniProtKB ID: Q92575, A8K9W4, Q4ZG56, Q8IYM5
Gene ID:
Human(23190) Summary: UBXD2 is an integral membrane protein of the endoplasmic reticulum (ER) that binds valosin-containing protein (VCP; MIM 601023) and promotes ER-associated protein degradation (ERAD) (Liang et al., 2006 [PubMed 16968747]
Mouse(67812) UBX domain protein 4
Rat(304766) UBX domain protein 4
naked mole-rat(101697764) UBX domain protein 4
domestic guinea pig(100735419) UBX domain protein 4
cow(536181) UBX domain protein 4
Goat(100861372) UBX domain protein 4
sheep(101104298) UBX domain protein 4
Zebrafish(406314) UBX domain protein 4
domestic cat(101093453) UBX domain protein 4
chicken(424293) UBX domain protein 4
dog(476130) UBX domain protein 4
108 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV47620 Anti-UBXD2 antibody produced in rabbit IgG fraction of antiserum guinea pig, rabbit, bovine, canine, zebrafish, human, mouse, rat, horse
immunohistochemistry, western blot pricing
HPA036325 Anti-UBXN4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, mouse, human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014607 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014607 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014607 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026390 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026390 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026390 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU036361 MISSION® esiRNA esiRNA human UBXN4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014607 Rosetta Predictions human pricing
NM_001012025 Rosetta Predictions rat pricing
XM_573443 Rosetta Predictions rat pricing
NM_026390 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014607 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243937 predicted 1868
2 SASI_Hs02_00345891 predicted 420
3 SASI_Hs01_00243938 predicted 1347
4 SASI_Hs01_00243939 predicted 541
5 SASI_Hs01_00243940 predicted 533
6 SASI_Hs01_00243941 predicted 1583
7 SASI_Hs01_00243942 predicted 562
8 SASI_Hs01_00243944 predicted 674
9 SASI_Hs01_00243945 predicted 1627
10 SASI_Hs02_00345892 predicted 1443
11 SASI_Hs01_00243943 predicted 1280
12 SASI_Hs01_00243946 predicted 266
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012025 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046965 predicted 1899
2 SASI_Rn01_00046966 predicted 423
3 SASI_Rn01_00046967 predicted 625
4 SASI_Rn01_00046968 predicted 1545
5 SASI_Rn01_00046970 predicted 414
6 SASI_Rn01_00046971 predicted 638
7 SASI_Rn01_00046972 predicted 1881
8 SASI_Rn01_00046973 predicted 609
9 SASI_Rn02_00200109 predicted 1803
10 SASI_Rn02_00200110 predicted 1292
11 SASI_Rn01_00046964 predicted 1318
12 SASI_Rn01_00046969 predicted 1635
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573443 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00174212 predicted 1355
2 SASI_Rn01_00174213 predicted 1943
3 SASI_Rn01_00174214 predicted 462
4 SASI_Rn01_00174215 predicted 664
5 SASI_Rn01_00174216 predicted 1587
6 SASI_Rn01_00174217 predicted 1673
7 SASI_Rn01_00174218 predicted 452
8 SASI_Rn01_00174219 predicted 679
9 SASI_Rn01_00174220 predicted 1916
10 SASI_Rn01_00174221 predicted 649
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026390 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330141 predicted 506
2 SASI_Mm02_00330142 predicted 420
3 SASI_Mm02_00330143 predicted 1492
4 SASI_Mm02_00330144 predicted 396
5 SASI_Mm02_00330145 predicted 489
6 SASI_Mm02_00330146 predicted 1387
7 SASI_Mm02_00330147 predicted 617
8 SASI_Mm02_00330148 predicted 513
9 SASI_Mm02_00330149 predicted 1901
10 SASI_Mm02_00330150 predicted 1260
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014607
VALIDATED
UBXN4 MISSION shRNA Bacterial Glycerol Stock
UBX domain protein 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014607.x-1114s1c1
Sequence:CCGGTCCGTCTTCCTGATGGTTCTTCTCGAGAAGAACCATCAGGAAGACGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014607.x-1125s1c1
Sequence:CCGGGATGGTTCTTCCTTTACAAATCTCGAGATTTGTAAAGGAAGAACCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014607.x-1364s1c1
Sequence:CCGGCAGCGGAGACATTTGGACCTTCTCGAGAAGGTCCAAATGTCTCCGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014607.x-585s1c1
Sequence:CCGGCAGTCCAGAAATGCAGAGCTTCTCGAGAAGCTCTGCATTTCTGGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004404    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014607.x-2952s1c1
Sequence:CCGGCGTTTGATCCAGTAGCTTCTTCTCGAGAAGAAGCTACTGGATCAAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014607.3-1370s21c1
Sequence:CCGGTGGCAACACTTACGGTAATTTCTCGAGAAATTACCGTAAGTGTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272765    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014607.3-2024s21c1
Sequence:CCGGCTGCTAGGTCCTTGCTTATATCTCGAGATATAAGCAAGGACCTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014607.3-705s21c1
Sequence:CCGGTCTACTCCATCTGCGTCATTTCTCGAGAAATGACGCAGATGGAGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014607.3-1293s21c1
Sequence:CCGGGATGGTTCTTCCTTTACAAATCTCGAGATTTGTAAAGGAAGAACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014607.3-1282s21c1
Sequence:CCGGTCCGTCTTCCTGATGGTTCTTCTCGAGAAGAACCATCAGGAAGACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014607
VALIDATED
UBXN4 MISSION shRNA shRNA Plasmid DNA
UBX domain protein 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014607.x-1114s1c1
Sequence:CCGGTCCGTCTTCCTGATGGTTCTTCTCGAGAAGAACCATCAGGAAGACGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014607.x-1125s1c1
Sequence:CCGGGATGGTTCTTCCTTTACAAATCTCGAGATTTGTAAAGGAAGAACCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014607.x-1364s1c1
Sequence:CCGGCAGCGGAGACATTTGGACCTTCTCGAGAAGGTCCAAATGTCTCCGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014607.x-585s1c1
Sequence:CCGGCAGTCCAGAAATGCAGAGCTTCTCGAGAAGCTCTGCATTTCTGGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004404    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014607.x-2952s1c1
Sequence:CCGGCGTTTGATCCAGTAGCTTCTTCTCGAGAAGAAGCTACTGGATCAAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014607.3-1370s21c1
Sequence:CCGGTGGCAACACTTACGGTAATTTCTCGAGAAATTACCGTAAGTGTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272765    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014607.3-2024s21c1
Sequence:CCGGCTGCTAGGTCCTTGCTTATATCTCGAGATATAAGCAAGGACCTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014607.3-705s21c1
Sequence:CCGGTCTACTCCATCTGCGTCATTTCTCGAGAAATGACGCAGATGGAGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014607.3-1293s21c1
Sequence:CCGGGATGGTTCTTCCTTTACAAATCTCGAGATTTGTAAAGGAAGAACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014607.3-1282s21c1
Sequence:CCGGTCCGTCTTCCTGATGGTTCTTCTCGAGAAGAACCATCAGGAAGACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014607
VALIDATED
UBXN4 MISSION shRNA Lentiviral Transduction Particles
UBX domain protein 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014607.x-1114s1c1
Sequence:CCGGTCCGTCTTCCTGATGGTTCTTCTCGAGAAGAACCATCAGGAAGACGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014607.x-1125s1c1
Sequence:CCGGGATGGTTCTTCCTTTACAAATCTCGAGATTTGTAAAGGAAGAACCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014607.x-1364s1c1
Sequence:CCGGCAGCGGAGACATTTGGACCTTCTCGAGAAGGTCCAAATGTCTCCGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014607.x-585s1c1
Sequence:CCGGCAGTCCAGAAATGCAGAGCTTCTCGAGAAGCTCTGCATTTCTGGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004404    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014607.x-2952s1c1
Sequence:CCGGCGTTTGATCCAGTAGCTTCTTCTCGAGAAGAAGCTACTGGATCAAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014607.3-1370s21c1
Sequence:CCGGTGGCAACACTTACGGTAATTTCTCGAGAAATTACCGTAAGTGTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272765    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014607.3-2024s21c1
Sequence:CCGGCTGCTAGGTCCTTGCTTATATCTCGAGATATAAGCAAGGACCTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014607.3-705s21c1
Sequence:CCGGTCTACTCCATCTGCGTCATTTCTCGAGAAATGACGCAGATGGAGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014607.3-1293s21c1
Sequence:CCGGGATGGTTCTTCCTTTACAAATCTCGAGATTTGTAAAGGAAGAACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014607.3-1282s21c1
Sequence:CCGGTCCGTCTTCCTGATGGTTCTTCTCGAGAAGAACCATCAGGAAGACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026390
UBXN4 MISSION shRNA Bacterial Glycerol Stock
UBX domain protein 4
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026390.1-636s1c1
Sequence:CCGGCCAACAGATGCACTCGTCAAACTCGAGTTTGACGAGTGCATCTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180107    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026390.1-893s1c1
Sequence:CCGGCCGTCAGAGTAGAAAGACTAACTCGAGTTAGTCTTTCTACTCTGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026390.2-549s21c1
Sequence:CCGGGGAATCCCTTTGGAAGTAATACTCGAGTATTACTTCCAAAGGGATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026390.2-1395s21c1
Sequence:CCGGTTCACCAGAGAAGACTATAAGCTCGAGCTTATAGTCTTCTCTGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026390.2-1343s21c1
Sequence:CCGGGGGCAACACCTATGGCAATTTCTCGAGAAATTGCCATAGGTGTTGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241056    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026390.2-2935s21c1
Sequence:CCGGAGCTATGAATAGTCCTAATATCTCGAGATATTAGGACTATTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026390.2-373s21c1
Sequence:CCGGGGGATGATGAGCAATCTATACCTCGAGGTATAGATTGCTCATCATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026390
UBXN4 MISSION shRNA shRNA Plasmid DNA
UBX domain protein 4
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026390.1-636s1c1
Sequence:CCGGCCAACAGATGCACTCGTCAAACTCGAGTTTGACGAGTGCATCTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180107    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026390.1-893s1c1
Sequence:CCGGCCGTCAGAGTAGAAAGACTAACTCGAGTTAGTCTTTCTACTCTGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026390.2-549s21c1
Sequence:CCGGGGAATCCCTTTGGAAGTAATACTCGAGTATTACTTCCAAAGGGATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026390.2-1395s21c1
Sequence:CCGGTTCACCAGAGAAGACTATAAGCTCGAGCTTATAGTCTTCTCTGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026390.2-1343s21c1
Sequence:CCGGGGGCAACACCTATGGCAATTTCTCGAGAAATTGCCATAGGTGTTGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241056    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026390.2-2935s21c1
Sequence:CCGGAGCTATGAATAGTCCTAATATCTCGAGATATTAGGACTATTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026390.2-373s21c1
Sequence:CCGGGGGATGATGAGCAATCTATACCTCGAGGTATAGATTGCTCATCATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026390
UBXN4 MISSION shRNA Lentiviral Transduction Particles
UBX domain protein 4
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026390.1-636s1c1
Sequence:CCGGCCAACAGATGCACTCGTCAAACTCGAGTTTGACGAGTGCATCTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180107    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026390.1-893s1c1
Sequence:CCGGCCGTCAGAGTAGAAAGACTAACTCGAGTTAGTCTTTCTACTCTGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026390.2-549s21c1
Sequence:CCGGGGAATCCCTTTGGAAGTAATACTCGAGTATTACTTCCAAAGGGATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026390.2-1395s21c1
Sequence:CCGGTTCACCAGAGAAGACTATAAGCTCGAGCTTATAGTCTTCTCTGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026390.2-1343s21c1
Sequence:CCGGGGGCAACACCTATGGCAATTTCTCGAGAAATTGCCATAGGTGTTGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241056    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026390.2-2935s21c1
Sequence:CCGGAGCTATGAATAGTCCTAATATCTCGAGATATTAGGACTATTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026390.2-373s21c1
Sequence:CCGGGGGATGATGAGCAATCTATACCTCGAGGTATAGATTGCTCATCATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks