EMAIL THIS PAGE TO A FRIEND

UBXN6

UBX domain protein 6

Synonyms: UBXD1 UBXDC2
UniProtKB ID: Q9BZV1, D6W626, Q96AH1, Q96IK9, Q9BZV0
Gene ID:
Mouse(66530) UBX domain protein 6
Rat(363332) UBX domain protein 6
Zebrafish(554960) UBX domain protein 6
dog(485037) UBX domain protein 6
domestic cat(101081118) UBX domain protein 6
chicken(428329) UBX domain protein 6
cow(507936) UBX domain protein 6
sheep(101111799) UBX domain protein 6
domestic guinea pig(100734568) UBX domain protein 6
naked mole-rat(101697965) UBX domain protein 6
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025241 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025241 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025241 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024432 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024432 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024432 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025241 Rosetta Predictions human pricing
NM_001108812 Rosetta Predictions rat pricing
NM_024432 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025241 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223283 predicted 699
2 SASI_Hs01_00223284 predicted 392
3 SASI_Hs01_00223285 predicted 1303
4 SASI_Hs01_00223286 predicted 525
5 SASI_Hs01_00223287 predicted 616
6 SASI_Hs01_00223288 predicted 699
7 SASI_Hs01_00223290 predicted 553
8 SASI_Hs01_00223291 predicted 749
9 SASI_Hs01_00223292 predicted 1403
10 SASI_Hs02_00358067 predicted 628
11 SASI_Hs01_00223289 predicted 403
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108812 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242315 predicted 1311
2 SASI_Rn02_00242316 predicted 459
3 SASI_Rn02_00242317 predicted 1271
4 SASI_Rn02_00242318 predicted 699
5 SASI_Rn02_00242319 predicted 908
6 SASI_Rn02_00242320 predicted 1008
7 SASI_Rn02_00242321 predicted 713
8 SASI_Rn02_00242322 predicted 1299
9 SASI_Rn02_00242323 predicted 942
10 SASI_Rn02_00242324 predicted 564
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024432 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067154 predicted 932
2 SASI_Mm01_00067156 predicted 1119
3 SASI_Mm01_00067157 predicted 1052
4 SASI_Mm01_00067159 predicted 1411
5 SASI_Mm02_00327749 predicted 597
6 SASI_Mm01_00067160 predicted 1014
7 SASI_Mm01_00067161 predicted 1137
8 SASI_Mm02_00327750 predicted 1061
9 SASI_Mm01_00067162 predicted 830
10 SASI_Mm01_00067163 predicted 288
11 SASI_Mm01_00067155 predicted 1393
12 SASI_Mm01_00067158 predicted 1182
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025241
VALIDATED
UBXN6 MISSION shRNA Bacterial Glycerol Stock
UBX domain protein 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025241.2-1450s21c1
Sequence:CCGGTGTGGGTCTGTCTCATGCTCTCTCGAGAGAGCATGAGACAGACCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025241.2-1647s21c1
Sequence:CCGGGGGACACCAACAAATCTAAGCCTCGAGGCTTAGATTTGTTGGTGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025241.2-332s21c1
Sequence:CCGGATCCGAAACCAGGTGAGAAAGCTCGAGCTTTCTCACCTGGTTTCGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025241.2-572s21c1
Sequence:CCGGATGAAGATCTACACGTTCAACCTCGAGGTTGAACGTGTAGATCTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_025241.1-967s1c1
Sequence:CCGGGACTTCTTCAACCTCACAGCACTCGAGTGCTGTGAGGTTGAAGAAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_025241.1-663s1c1
Sequence:CCGGCGAGGAGGAGAAGTACCGGAACTCGAGTTCCGGTACTTCTCCTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_025241.1-189s1c1
Sequence:CCGGCCACAAAGAGAAGCCCAACCACTCGAGTGGTTGGGCTTCTCTTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_025241.1-1311s1c1
Sequence:CCGGCCTGACCTTCTCGTGGGACATCTCGAGATGTCCCACGAGAAGGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022449    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_025241.1-1509s1c1
Sequence:CCGGCCTCTGGAAATACTTGGCTCTCTCGAGAGAGCCAAGTATTTCCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025241
VALIDATED
UBXN6 MISSION shRNA shRNA Plasmid DNA
UBX domain protein 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025241.2-1450s21c1
Sequence:CCGGTGTGGGTCTGTCTCATGCTCTCTCGAGAGAGCATGAGACAGACCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025241.2-1647s21c1
Sequence:CCGGGGGACACCAACAAATCTAAGCCTCGAGGCTTAGATTTGTTGGTGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025241.2-332s21c1
Sequence:CCGGATCCGAAACCAGGTGAGAAAGCTCGAGCTTTCTCACCTGGTTTCGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025241.2-572s21c1
Sequence:CCGGATGAAGATCTACACGTTCAACCTCGAGGTTGAACGTGTAGATCTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_025241.1-967s1c1
Sequence:CCGGGACTTCTTCAACCTCACAGCACTCGAGTGCTGTGAGGTTGAAGAAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_025241.1-663s1c1
Sequence:CCGGCGAGGAGGAGAAGTACCGGAACTCGAGTTCCGGTACTTCTCCTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_025241.1-189s1c1
Sequence:CCGGCCACAAAGAGAAGCCCAACCACTCGAGTGGTTGGGCTTCTCTTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_025241.1-1311s1c1
Sequence:CCGGCCTGACCTTCTCGTGGGACATCTCGAGATGTCCCACGAGAAGGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022449    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_025241.1-1509s1c1
Sequence:CCGGCCTCTGGAAATACTTGGCTCTCTCGAGAGAGCCAAGTATTTCCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025241
VALIDATED
UBXN6 MISSION shRNA Lentiviral Transduction Particles
UBX domain protein 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025241.2-1450s21c1
Sequence:CCGGTGTGGGTCTGTCTCATGCTCTCTCGAGAGAGCATGAGACAGACCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025241.2-1647s21c1
Sequence:CCGGGGGACACCAACAAATCTAAGCCTCGAGGCTTAGATTTGTTGGTGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025241.2-332s21c1
Sequence:CCGGATCCGAAACCAGGTGAGAAAGCTCGAGCTTTCTCACCTGGTTTCGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025241.2-572s21c1
Sequence:CCGGATGAAGATCTACACGTTCAACCTCGAGGTTGAACGTGTAGATCTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_025241.1-967s1c1
Sequence:CCGGGACTTCTTCAACCTCACAGCACTCGAGTGCTGTGAGGTTGAAGAAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_025241.1-663s1c1
Sequence:CCGGCGAGGAGGAGAAGTACCGGAACTCGAGTTCCGGTACTTCTCCTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_025241.1-189s1c1
Sequence:CCGGCCACAAAGAGAAGCCCAACCACTCGAGTGGTTGGGCTTCTCTTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_025241.1-1311s1c1
Sequence:CCGGCCTGACCTTCTCGTGGGACATCTCGAGATGTCCCACGAGAAGGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022449    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_025241.1-1509s1c1
Sequence:CCGGCCTCTGGAAATACTTGGCTCTCTCGAGAGAGCCAAGTATTTCCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024432
VALIDATED
UBXN6 MISSION shRNA Bacterial Glycerol Stock
UBX domain protein 6
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000278980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024432.2-1147s21c1
Sequence:CCGGTATCCGCGCTCTTCCGATTTGCTCGAGCAAATCGGAAGAGCGCGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024432.2-593s21c1
Sequence:CCGGTGTGGATACTATCGCCAAATACTCGAGTATTTGGCGATAGTATCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297161    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024432.2-1440s21c1
Sequence:CCGGCTGTTCCCAAACCCATTCCTTCTCGAGAAGGAATGGGTTTGGGAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024432.2-538s21c1
Sequence:CCGGCCTCCATCATGAAGATACATACTCGAGTATGTATCTTCATGATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024432.2-1065s21c1
Sequence:CCGGCGCAAGTATACCTATGCCCTTCTCGAGAAGGGCATAGGTATACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024432.2-538s1c1
Sequence:CCGGCCTCCATCATGAAGATACATACTCGAGTATGTATCTTCATGATGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024432.2-1475s1c1
Sequence:CCGGGCAATAGGAAGGACAGTAGTACTCGAGTACTACTGTCCTTCCTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189472    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024432.2-1440s1c1
Sequence:CCGGCTGTTCCCAAACCCATTCCTTCTCGAGAAGGAATGGGTTTGGGAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024432.2-1065s1c1
Sequence:CCGGCGCAAGTATACCTATGCCCTTCTCGAGAAGGGCATAGGTATACTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024432
VALIDATED
UBXN6 MISSION shRNA shRNA Plasmid DNA
UBX domain protein 6
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000278980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024432.2-1147s21c1
Sequence:CCGGTATCCGCGCTCTTCCGATTTGCTCGAGCAAATCGGAAGAGCGCGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024432.2-593s21c1
Sequence:CCGGTGTGGATACTATCGCCAAATACTCGAGTATTTGGCGATAGTATCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297161    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024432.2-1440s21c1
Sequence:CCGGCTGTTCCCAAACCCATTCCTTCTCGAGAAGGAATGGGTTTGGGAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024432.2-538s21c1
Sequence:CCGGCCTCCATCATGAAGATACATACTCGAGTATGTATCTTCATGATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024432.2-1065s21c1
Sequence:CCGGCGCAAGTATACCTATGCCCTTCTCGAGAAGGGCATAGGTATACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024432.2-538s1c1
Sequence:CCGGCCTCCATCATGAAGATACATACTCGAGTATGTATCTTCATGATGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024432.2-1475s1c1
Sequence:CCGGGCAATAGGAAGGACAGTAGTACTCGAGTACTACTGTCCTTCCTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189472    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024432.2-1440s1c1
Sequence:CCGGCTGTTCCCAAACCCATTCCTTCTCGAGAAGGAATGGGTTTGGGAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024432.2-1065s1c1
Sequence:CCGGCGCAAGTATACCTATGCCCTTCTCGAGAAGGGCATAGGTATACTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024432
VALIDATED
UBXN6 MISSION shRNA Lentiviral Transduction Particles
UBX domain protein 6
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000278980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024432.2-1147s21c1
Sequence:CCGGTATCCGCGCTCTTCCGATTTGCTCGAGCAAATCGGAAGAGCGCGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024432.2-593s21c1
Sequence:CCGGTGTGGATACTATCGCCAAATACTCGAGTATTTGGCGATAGTATCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297161    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024432.2-1440s21c1
Sequence:CCGGCTGTTCCCAAACCCATTCCTTCTCGAGAAGGAATGGGTTTGGGAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024432.2-538s21c1
Sequence:CCGGCCTCCATCATGAAGATACATACTCGAGTATGTATCTTCATGATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024432.2-1065s21c1
Sequence:CCGGCGCAAGTATACCTATGCCCTTCTCGAGAAGGGCATAGGTATACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024432.2-538s1c1
Sequence:CCGGCCTCCATCATGAAGATACATACTCGAGTATGTATCTTCATGATGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024432.2-1475s1c1
Sequence:CCGGGCAATAGGAAGGACAGTAGTACTCGAGTACTACTGTCCTTCCTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189472    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024432.2-1440s1c1
Sequence:CCGGCTGTTCCCAAACCCATTCCTTCTCGAGAAGGAATGGGTTTGGGAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024432.2-1065s1c1
Sequence:CCGGCGCAAGTATACCTATGCCCTTCTCGAGAAGGGCATAGGTATACTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks