EMAIL THIS PAGE TO A FRIEND

UBXN7

UBX domain protein 7

Synonyms: UBXD7
UniProtKB ID: O94888, D3DXB3, Q6ZP77, Q86X20, Q8N327
Gene ID:
Mouse(224111) UBX domain protein 7
Rat(303878) UBX domain protein 7
naked mole-rat(101707384) UBX domain protein 7
domestic guinea pig(100714793) UBX domain protein 7
cow(539940) UBX domain protein 7
sheep(101121477) UBX domain protein 7
Zebrafish(402913) UBX domain protein 7
domestic cat(101100501) UBX domain protein 7
dog(488028) UBX domain protein 7
chicken(424856) UBX domain protein 7
187 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177633 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177633 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177633 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015562 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015562 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015562 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015562 Rosetta Predictions human pricing
XM_087353 Rosetta Predictions human pricing
XM_931517 Rosetta Predictions human pricing
XM_931530 Rosetta Predictions human pricing
NM_001107086 Rosetta Predictions rat pricing
XM_619387 Rosetta Predictions mouse pricing
XM_914704 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015562 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348108 predicted 797
2 SASI_Hs02_00348109 predicted 1066
3 SASI_Hs02_00348110 predicted 419
4 SASI_Hs02_00348111 predicted 939
5 SASI_Hs02_00348112 predicted 1467
6 SASI_Hs02_00348113 predicted 1436
7 SASI_Hs02_00348114 predicted 499
8 SASI_Hs02_00348115 predicted 1092
9 SASI_Hs02_00348116 predicted 925
10 SASI_Hs02_00348117 predicted 257
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_087353 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00289205 predicted 648
2 SASI_Hs01_00289206 predicted 1275
3 SASI_Hs01_00289207 predicted 475
4 SASI_Hs01_00289208 predicted 386
5 SASI_Hs01_00289209 predicted 316
6 SASI_Hs01_00289210 predicted 1353
7 SASI_Hs01_00289211 predicted 1436
8 SASI_Hs01_00289212 predicted 1411
9 SASI_Hs01_00289213 predicted 575
10 SASI_Hs01_00289214 predicted 498
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931517 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00293188 predicted 287
2 SASI_Hs01_00293189 predicted 241
3 SASI_Hs01_00293190 predicted 293
4 SASI_Hs01_00293191 predicted 331
5 SASI_Hs01_00293192 predicted 200
6 SASI_Hs01_00293193 predicted 327
7 SASI_Hs01_00293194 predicted 284
8 SASI_Hs01_00293195 predicted 233
9 SASI_Hs01_00293196 predicted 288
10 SASI_Hs01_00293197 predicted 272
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931530 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00254696 predicted 356
2 SASI_Hs01_00254697 predicted 466
3 SASI_Hs01_00254698 predicted 1095
4 SASI_Hs01_00254699 predicted 416
5 SASI_Hs01_00254700 predicted 326
6 SASI_Hs01_00254701 predicted 1172
7 SASI_Hs01_00254702 predicted 1256
8 SASI_Hs01_00254703 predicted 1221
9 SASI_Hs01_00254704 predicted 393
10 SASI_Hs01_00254705 predicted 311
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107086 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225356 predicted 373
2 SASI_Rn02_00225357 predicted 512
3 SASI_Rn02_00225358 predicted 677
4 SASI_Rn02_00225359 predicted 332
5 SASI_Rn02_00225360 predicted 417
6 SASI_Rn02_00225361 predicted 340
7 SASI_Rn02_00225362 predicted 426
8 SASI_Rn02_00225363 predicted 490
9 SASI_Rn02_00225364 predicted 505
10 SASI_Rn02_00225365 predicted 453
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_619387 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00247157 predicted 653
2 SASI_Mm01_00247158 predicted 1750
3 SASI_Mm01_00247159 predicted 514
4 SASI_Mm02_00427387 predicted 1776
5 SASI_Mm01_00247160 predicted 1047
6 SASI_Mm01_00247161 predicted 1060
7 SASI_Mm01_00247162 predicted 1255
8 SASI_Mm01_00247163 predicted 1564
9 SASI_Mm01_00247164 predicted 1253
10 SASI_Mm01_00247165 predicted 1531
11 SASI_Mm01_00247166 predicted 625
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_914704 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00438823 predicted 648
2 SASI_Mm02_00438824 predicted 1750
3 SASI_Mm02_00438825 predicted 512
4 SASI_Mm02_00438826 predicted 1781
5 SASI_Mm02_00438827 predicted 1049
6 SASI_Mm02_00438828 predicted 1056
7 SASI_Mm02_00438829 predicted 1257
8 SASI_Mm02_00438830 predicted 1559
9 SASI_Mm02_00438831 predicted 1258
10 SASI_Mm02_00438832 predicted 1527
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177633
VALIDATED
UBXN7 MISSION shRNA Bacterial Glycerol Stock
UBX domain protein 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000339993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177633.3-1363s21c1
Sequence:CCGGCAGTCTAAAGGATATCCAAATCTCGAGATTTGGATATCCTTTAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339996    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177633.3-1779s21c1
Sequence:CCGGCTAGTACTGGTAGCACGAAATCTCGAGATTTCGTGCTACCAGTACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177633.3-337s21c1
Sequence:CCGGAGAAGGCCAGCACGTTCAATACTCGAGTATTGAACGTGCTGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177633.3-1427s21c1
Sequence:CCGGCTCATCTGGACTATGACATTACTCGAGTAATGTCATAGTCCAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177633.3-442s21c1
Sequence:CCGGACCACCCTTGCAGATCTATTTCTCGAGAAATAGATCTGCAAGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177633
VALIDATED
UBXN7 MISSION shRNA shRNA Plasmid DNA
UBX domain protein 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000339993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177633.3-1363s21c1
Sequence:CCGGCAGTCTAAAGGATATCCAAATCTCGAGATTTGGATATCCTTTAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339996    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177633.3-1779s21c1
Sequence:CCGGCTAGTACTGGTAGCACGAAATCTCGAGATTTCGTGCTACCAGTACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177633.3-337s21c1
Sequence:CCGGAGAAGGCCAGCACGTTCAATACTCGAGTATTGAACGTGCTGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177633.3-1427s21c1
Sequence:CCGGCTCATCTGGACTATGACATTACTCGAGTAATGTCATAGTCCAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177633.3-442s21c1
Sequence:CCGGACCACCCTTGCAGATCTATTTCTCGAGAAATAGATCTGCAAGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177633
VALIDATED
UBXN7 MISSION shRNA Lentiviral Transduction Particles
UBX domain protein 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000339993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177633.3-1363s21c1
Sequence:CCGGCAGTCTAAAGGATATCCAAATCTCGAGATTTGGATATCCTTTAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339996    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177633.3-1779s21c1
Sequence:CCGGCTAGTACTGGTAGCACGAAATCTCGAGATTTCGTGCTACCAGTACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177633.3-337s21c1
Sequence:CCGGAGAAGGCCAGCACGTTCAATACTCGAGTATTGAACGTGCTGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177633.3-1427s21c1
Sequence:CCGGCTCATCTGGACTATGACATTACTCGAGTAATGTCATAGTCCAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177633.3-442s21c1
Sequence:CCGGACCACCCTTGCAGATCTATTTCTCGAGAAATAGATCTGCAAGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015562
VALIDATED
UBXN7 MISSION shRNA Bacterial Glycerol Stock
UBX domain protein 7
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015562.1-2901s21c1
Sequence:CCGGCCCTATGCTCATTTCGTATTTCTCGAGAAATACGAAATGAGCATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015562.1-176s21c1
Sequence:CCGGTGCTTGAAGCGTGCAACAATACTCGAGTATTGTTGCACGCTTCAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015562.1-498s21c1
Sequence:CCGGATTCCGGCCACCCATTGATTTCTCGAGAAATCAATGGGTGGCCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015562.1-339s21c1
Sequence:CCGGGGTGGAACCAGAACCATTATTCTCGAGAATAATGGTTCTGGTTCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015562.1-377s21c1
Sequence:CCGGGACGGCCTGCACGTTCAATTTCTCGAGAAATTGAACGTGCAGGCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015562
VALIDATED
UBXN7 MISSION shRNA shRNA Plasmid DNA
UBX domain protein 7
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015562.1-2901s21c1
Sequence:CCGGCCCTATGCTCATTTCGTATTTCTCGAGAAATACGAAATGAGCATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015562.1-176s21c1
Sequence:CCGGTGCTTGAAGCGTGCAACAATACTCGAGTATTGTTGCACGCTTCAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015562.1-498s21c1
Sequence:CCGGATTCCGGCCACCCATTGATTTCTCGAGAAATCAATGGGTGGCCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015562.1-339s21c1
Sequence:CCGGGGTGGAACCAGAACCATTATTCTCGAGAATAATGGTTCTGGTTCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015562.1-377s21c1
Sequence:CCGGGACGGCCTGCACGTTCAATTTCTCGAGAAATTGAACGTGCAGGCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015562
VALIDATED
UBXN7 MISSION shRNA Lentiviral Transduction Particles
UBX domain protein 7
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015562.1-2901s21c1
Sequence:CCGGCCCTATGCTCATTTCGTATTTCTCGAGAAATACGAAATGAGCATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015562.1-176s21c1
Sequence:CCGGTGCTTGAAGCGTGCAACAATACTCGAGTATTGTTGCACGCTTCAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015562.1-498s21c1
Sequence:CCGGATTCCGGCCACCCATTGATTTCTCGAGAAATCAATGGGTGGCCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015562.1-339s21c1
Sequence:CCGGGGTGGAACCAGAACCATTATTCTCGAGAATAATGGTTCTGGTTCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015562.1-377s21c1
Sequence:CCGGGACGGCCTGCACGTTCAATTTCTCGAGAAATTGAACGTGCAGGCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks