EMAIL THIS PAGE TO A FRIEND

UBXN8

UBX domain protein 8

Synonyms: D8S2298E REP8 UBXD6
UniProtKB ID: O00124, Q7Z6F2
Gene ID:
Mouse(108159) UBX domain protein 8
Rat(290802) UBX domain protein 8
Zebrafish(554116) UBX domain protein 8
domestic cat(101090764) UBX domain protein 8
dog(475595) UBX domain protein 8
cow(509646) UBX domain protein 8
sheep(101106055) UBX domain protein 8
Goat(100861098) UBX domain protein 8
domestic guinea pig(100719063) UBX domain protein 8
naked mole-rat(101726065) UBX domain protein 8
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178648 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178648 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178648 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005671 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005671 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005671 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005671 Rosetta Predictions human pricing
NM_001106086 Rosetta Predictions rat pricing
NM_178648 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005671 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211658 predicted 484
2 SASI_Hs01_00211659 predicted 535
3 SASI_Hs01_00211660 predicted 529
4 SASI_Hs01_00211661 predicted 869
5 SASI_Hs01_00211663 predicted 849
6 SASI_Hs02_00340057 predicted 951
7 SASI_Hs01_00211664 predicted 1095
8 SASI_Hs02_00340058 predicted 931
9 SASI_Hs01_00211665 predicted 677
10 SASI_Hs01_00211667 predicted 884
11 SASI_Hs01_00211662 predicted 1077
12 SASI_Hs01_00211666 predicted 1059
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106086 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215492 predicted 1948
2 SASI_Rn02_00215493 predicted 2169
3 SASI_Rn02_00215494 predicted 1564
4 SASI_Rn02_00215495 predicted 2063
5 SASI_Rn02_00215496 predicted 2066
6 SASI_Rn02_00215497 predicted 1496
7 SASI_Rn02_00215498 predicted 1884
8 SASI_Rn02_00215499 predicted 1684
9 SASI_Rn02_00215500 predicted 1684
10 SASI_Rn02_00215501 predicted 2164
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178648 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349061 predicted 739
2 SASI_Mm02_00349062 predicted 1018
3 SASI_Mm02_00349063 predicted 516
4 SASI_Mm02_00349064 predicted 726
5 SASI_Mm02_00349065 predicted 1195
6 SASI_Mm02_00349066 predicted 1116
7 SASI_Mm02_00349067 predicted 833
8 SASI_Mm02_00349068 predicted 209
9 SASI_Mm02_00349069 predicted 694
10 SASI_Mm02_00349070 predicted 224
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178648
VALIDATED
UBXN8 MISSION shRNA Bacterial Glycerol Stock
UBX domain protein 8
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178648.2-720s21c1
Sequence:CCGGGATGAAAGTTGGGTACCACAACTCGAGTTGTGGTACCCAACTTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216175    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178648.2-2216s1c1
Sequence:CCGGCCTAATGAAATGCTTAGATATCTCGAGATATCTAAGCATTTCATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216410    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178648.2-2257s1c1
Sequence:CCGGGGTCTAACAGTTATCAGTATTCTCGAGAATACTGATAACTGTTAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217605    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178648.2-316s1c1
Sequence:CCGGGAGAAGGCCAGCAGATATATACTCGAGTATATATCTGCTGGCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178648.2-115s21c1
Sequence:CCGGATCCCGAGTCTCGGCATTAAACTCGAGTTTAATGCCGAGACTCGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276932    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178648.2-1183s21c1
Sequence:CCGGTTGCGTCTACCTTACCATAAACTCGAGTTTATGGTAAGGTAGACGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178648.2-829s21c1
Sequence:CCGGGACACTGTACTTAACGTGGAACTCGAGTTCCACGTTAAGTACAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178648.2-145s21c1
Sequence:CCGGTTGCTGAGTGGCCGGATATTCCTCGAGGAATATCCGGCCACTCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178648.1-599s1c1
Sequence:CCGGGTTGGGTACCACAAATCCCTACTCGAGTAGGGATTTGTGGTACCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178648.1-323s1c1
Sequence:CCGGGATGAAGATTCGGAGTTTGAACTCGAGTTCAAACTCCGAATCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178648.1-592s1c1
Sequence:CCGGGATGAAAGTTGGGTACCACAACTCGAGTTGTGGTACCCAACTTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178648.1-701s1c1
Sequence:CCGGGACACTGTACTTAACGTGGAACTCGAGTTCCACGTTAAGTACAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178648.1-365s1c1
Sequence:CCGGGAAACAATAAACGGAGAGGCACTCGAGTGCCTCTCCGTTTATTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178648.1-227s1c1
Sequence:CCGGCAGCAGGAAATGAAGTTGAAACTCGAGTTTCAACTTCATTTCCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178648
VALIDATED
UBXN8 MISSION shRNA shRNA Plasmid DNA
UBX domain protein 8
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178648.2-720s21c1
Sequence:CCGGGATGAAAGTTGGGTACCACAACTCGAGTTGTGGTACCCAACTTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216175    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178648.2-2216s1c1
Sequence:CCGGCCTAATGAAATGCTTAGATATCTCGAGATATCTAAGCATTTCATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216410    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178648.2-2257s1c1
Sequence:CCGGGGTCTAACAGTTATCAGTATTCTCGAGAATACTGATAACTGTTAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217605    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178648.2-316s1c1
Sequence:CCGGGAGAAGGCCAGCAGATATATACTCGAGTATATATCTGCTGGCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178648.2-115s21c1
Sequence:CCGGATCCCGAGTCTCGGCATTAAACTCGAGTTTAATGCCGAGACTCGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276932    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178648.2-1183s21c1
Sequence:CCGGTTGCGTCTACCTTACCATAAACTCGAGTTTATGGTAAGGTAGACGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178648.2-829s21c1
Sequence:CCGGGACACTGTACTTAACGTGGAACTCGAGTTCCACGTTAAGTACAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178648.2-145s21c1
Sequence:CCGGTTGCTGAGTGGCCGGATATTCCTCGAGGAATATCCGGCCACTCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178648.1-599s1c1
Sequence:CCGGGTTGGGTACCACAAATCCCTACTCGAGTAGGGATTTGTGGTACCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178648.1-323s1c1
Sequence:CCGGGATGAAGATTCGGAGTTTGAACTCGAGTTCAAACTCCGAATCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178648.1-592s1c1
Sequence:CCGGGATGAAAGTTGGGTACCACAACTCGAGTTGTGGTACCCAACTTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178648.1-701s1c1
Sequence:CCGGGACACTGTACTTAACGTGGAACTCGAGTTCCACGTTAAGTACAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178648.1-365s1c1
Sequence:CCGGGAAACAATAAACGGAGAGGCACTCGAGTGCCTCTCCGTTTATTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178648.1-227s1c1
Sequence:CCGGCAGCAGGAAATGAAGTTGAAACTCGAGTTTCAACTTCATTTCCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178648
VALIDATED
UBXN8 MISSION shRNA Lentiviral Transduction Particles
UBX domain protein 8
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178648.2-720s21c1
Sequence:CCGGGATGAAAGTTGGGTACCACAACTCGAGTTGTGGTACCCAACTTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216175    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178648.2-2216s1c1
Sequence:CCGGCCTAATGAAATGCTTAGATATCTCGAGATATCTAAGCATTTCATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216410    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178648.2-2257s1c1
Sequence:CCGGGGTCTAACAGTTATCAGTATTCTCGAGAATACTGATAACTGTTAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217605    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178648.2-316s1c1
Sequence:CCGGGAGAAGGCCAGCAGATATATACTCGAGTATATATCTGCTGGCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178648.2-115s21c1
Sequence:CCGGATCCCGAGTCTCGGCATTAAACTCGAGTTTAATGCCGAGACTCGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276932    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178648.2-1183s21c1
Sequence:CCGGTTGCGTCTACCTTACCATAAACTCGAGTTTATGGTAAGGTAGACGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178648.2-829s21c1
Sequence:CCGGGACACTGTACTTAACGTGGAACTCGAGTTCCACGTTAAGTACAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178648.2-145s21c1
Sequence:CCGGTTGCTGAGTGGCCGGATATTCCTCGAGGAATATCCGGCCACTCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178648.1-599s1c1
Sequence:CCGGGTTGGGTACCACAAATCCCTACTCGAGTAGGGATTTGTGGTACCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178648.1-323s1c1
Sequence:CCGGGATGAAGATTCGGAGTTTGAACTCGAGTTCAAACTCCGAATCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178648.1-592s1c1
Sequence:CCGGGATGAAAGTTGGGTACCACAACTCGAGTTGTGGTACCCAACTTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178648.1-701s1c1
Sequence:CCGGGACACTGTACTTAACGTGGAACTCGAGTTCCACGTTAAGTACAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178648.1-365s1c1
Sequence:CCGGGAAACAATAAACGGAGAGGCACTCGAGTGCCTCTCCGTTTATTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178648.1-227s1c1
Sequence:CCGGCAGCAGGAAATGAAGTTGAAACTCGAGTTTCAACTTCATTTCCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005671
VALIDATED
UBXN8 MISSION shRNA Bacterial Glycerol Stock
UBX domain protein 8
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000277800    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005671.2-885s21c1
Sequence:CCGGGCACAATAAAGGCTTCACTTTCTCGAGAAAGTGAAGCCTTTATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_005671.2-304s21c1
Sequence:CCGGGCAGATACATAGAGAATGTTTCTCGAGAAACATTCTCTATGTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_005671.2-491s21c1
Sequence:CCGGGCCTAAACCTTTAACTGAATTCTCGAGAATTCAGTTAAAGGTTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_005671.2-213s21c1
Sequence:CCGGCAAGTTTATCTGAAGGAAGAACTCGAGTTCTTCCTTCAGATAAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007495    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005671.1-883s1c1
Sequence:CCGGGCACAATAAAGGCTTCACTTTCTCGAGAAAGTGAAGCCTTTATTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005671.1-302s1c1
Sequence:CCGGGCAGATACATAGAGAATGTTTCTCGAGAAACATTCTCTATGTATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005671.1-211s1c1
Sequence:CCGGCAAGTTTATCTGAAGGAAGAACTCGAGTTCTTCCTTCAGATAAACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_005671.1-95s1c1
Sequence:CCGGCGGATATAGGAATCAAGGATTCTCGAGAATCCTTGATTCCTATATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005671.1-489s1c1
Sequence:CCGGGCCTAAACCTTTAACTGAATTCTCGAGAATTCAGTTAAAGGTTTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005671
VALIDATED
UBXN8 MISSION shRNA shRNA Plasmid DNA
UBX domain protein 8
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000277800    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005671.2-885s21c1
Sequence:CCGGGCACAATAAAGGCTTCACTTTCTCGAGAAAGTGAAGCCTTTATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_005671.2-304s21c1
Sequence:CCGGGCAGATACATAGAGAATGTTTCTCGAGAAACATTCTCTATGTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_005671.2-491s21c1
Sequence:CCGGGCCTAAACCTTTAACTGAATTCTCGAGAATTCAGTTAAAGGTTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_005671.2-213s21c1
Sequence:CCGGCAAGTTTATCTGAAGGAAGAACTCGAGTTCTTCCTTCAGATAAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007495    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005671.1-883s1c1
Sequence:CCGGGCACAATAAAGGCTTCACTTTCTCGAGAAAGTGAAGCCTTTATTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005671.1-302s1c1
Sequence:CCGGGCAGATACATAGAGAATGTTTCTCGAGAAACATTCTCTATGTATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005671.1-211s1c1
Sequence:CCGGCAAGTTTATCTGAAGGAAGAACTCGAGTTCTTCCTTCAGATAAACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_005671.1-95s1c1
Sequence:CCGGCGGATATAGGAATCAAGGATTCTCGAGAATCCTTGATTCCTATATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005671.1-489s1c1
Sequence:CCGGGCCTAAACCTTTAACTGAATTCTCGAGAATTCAGTTAAAGGTTTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005671
VALIDATED
UBXN8 MISSION shRNA Lentiviral Transduction Particles
UBX domain protein 8
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000277800    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005671.2-885s21c1
Sequence:CCGGGCACAATAAAGGCTTCACTTTCTCGAGAAAGTGAAGCCTTTATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_005671.2-304s21c1
Sequence:CCGGGCAGATACATAGAGAATGTTTCTCGAGAAACATTCTCTATGTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_005671.2-491s21c1
Sequence:CCGGGCCTAAACCTTTAACTGAATTCTCGAGAATTCAGTTAAAGGTTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_005671.2-213s21c1
Sequence:CCGGCAAGTTTATCTGAAGGAAGAACTCGAGTTCTTCCTTCAGATAAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007495    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005671.1-883s1c1
Sequence:CCGGGCACAATAAAGGCTTCACTTTCTCGAGAAAGTGAAGCCTTTATTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005671.1-302s1c1
Sequence:CCGGGCAGATACATAGAGAATGTTTCTCGAGAAACATTCTCTATGTATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005671.1-211s1c1
Sequence:CCGGCAAGTTTATCTGAAGGAAGAACTCGAGTTCTTCCTTCAGATAAACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_005671.1-95s1c1
Sequence:CCGGCGGATATAGGAATCAAGGATTCTCGAGAATCCTTGATTCCTATATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005671.1-489s1c1
Sequence:CCGGGCCTAAACCTTTAACTGAATTCTCGAGAATTCAGTTAAAGGTTTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks