EMAIL THIS PAGE TO A FRIEND

UCHL1

ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase)

Synonyms: PARK5 PGP 9.5 PGP9.5 PGP95 Uch-L1
UniProtKB ID: P09936, Q4W5K6, Q71UM0
Gene ID:
Human(7345) Summary: The protein encoded by this gene belongs to the peptidase C12 family. This enzyme is a thiol protease that hydrolyzes a peptide bond at the C-terminal glycine of ubiquitin. This gene is specifically expressed in the neurons and in cells of the diffuse neuroendocrine system. Mutations in this gene may be associated with Parkinson disease.[provided by RefSeq, Sep 2009]
Mouse(22223) ubiquitin carboxy-terminal hydrolase L1
Rat(29545) ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase)
Zebrafish(325119) ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase)
Horse(100033838) ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase)
dog(479098) ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase)
domestic cat(101093604) ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase)
chicken(770302) ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase)
cow(514394) ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase)
sheep(101117250) ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase)
naked mole-rat(101702892) ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase)
domestic guinea pig(100714582) ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase)
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4503057 Anti-PGP9.5, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
U5133 Anti-Ubiquitin C-terminal Hydrolase L1 (MA-18) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse, rat
microarray, western blot pricing
U5258 Anti-Ubiquitin C-terminal Hydrolase L1 (RA-15) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution rat, mouse, human
microarray, western blot pricing
U5383 Anti-Ubiquitin C-terminal Hydrolase L1 (TS-21) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution rat, mouse, human
western blot pricing
SAB2501668 Anti-UCHL1 (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution bovine, rat, canine, rabbit, pig, human
ELISA, western blot pricing
GW22910 Anti-UCHL1 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB2501667 Anti-UCHL1 antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, pig, canine, human, bovine
ELISA, western blot pricing
HPA005993 Anti-UCHL1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
WH0007345M1 Monoclonal Anti-UCHL1 antibody produced in mouse clone 1B8-4D2, purified immunoglobulin, buffered aqueous solution human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB1404510 Monoclonal Anti-UCHL1 antibody produced in mouse clone S1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
AMAB91145 Monoclonal Anti-UCHL1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL3210, purified immunoglobulin, buffered aqueous glycerol solution rat, mouse, human
immunohistochemistry, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB1766 Human UCH-L1 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011670 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011670 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011670 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004181 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004181 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004181 MISSION® shRNA Lentiviral Transduction Particles human pricing

Related Products

Product # Description Species Add to Cart
 
AB1761-I Anti-Protein Gene Product 9.5 Antibody 100 µg, Detect PGP9.5 using this rabbit polyclonal antibody, Anti-Protein Gene Product 9.5 Antibody validated for use in western blotting, IHC (Paraffin), Immunofluorescence & ICC. pricing
AB5898 Anti-Protein Gene Product 9.5 Antibody 50 µL, Anti-Protein Gene Product 9.5 Antibody detects level of Protein Gene Product 9.5 & has been published & validated for use in IH. pricing
AB5925 Anti-Protein Gene Product 9.5 Antibody 50 µL, Detect Protein Gene Product 9.5 using this Anti-Protein Gene Product 9.5 Antibody validated for use in WB, IH. pricing
AB5937 Anti-Ubiquitin Carboxyl-Terminal Hydrolase L1 Antibody, a.a. 61-78 of hUCH-L1 200 µL, Anti-Ubiquitin Carboxyl-Terminal Hydrolase L1 Antibody, a.a. 61-78 of hUCH-L1 is an antibody against Ubiquitin Carboxyl-Terminal Hydrolase L1 for use in ELISA & WB. pricing
ABN22 Anti-UCH-L1 Antibody 100 µg, This Anti-UCH-L1 Antibody is validated for use in WB for the detection of UCH-L1. pricing
MABN48 Anti-UCHL1 Antibody, clone MCA-BH7 100 µL, Detect UCH-L1 using this mouse monoclonal antibody, Anti-UCHL1 Antibody, clone MCA-BH7 validated for use in western blotting & Immunofluorescence. pricing
14-855 Ubiquitin C-terminal hydrolase L1 (UCH-L1), 50 µg 50 µg, From human cDNA, expressed in E. coli. Ubiquitin C-terminal hydrolases are a family of cysteine hydrolases that catalyze the hydrolysis of amides, esters & thioesters of the C-terminus of ubiquitin. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004181 Rosetta Predictions human pricing
NM_017237 Rosetta Predictions rat pricing
NM_011670 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004181 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178415 predicted 277
2 SASI_Hs01_00178416 predicted 359
3 SASI_Hs01_00178417 predicted 339
4 SASI_Hs02_00337062 predicted 289
5 SASI_Hs01_00178418 predicted 311
6 SASI_Hs02_00337063 predicted 271
7 SASI_Hs01_00178419 predicted 508
8 SASI_Hs01_00178420 predicted 276
9 SASI_Hs01_00178421 predicted 650
10 SASI_Hs01_00178422 predicted 469
11 SASI_Hs01_00178423 predicted 530
12 SASI_Hs01_00178424 predicted 329
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017237 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115917 predicted 267
2 SASI_Rn01_00115918 predicted 260
3 SASI_Rn01_00115919 predicted 374
4 SASI_Rn01_00115920 predicted 277
5 SASI_Rn01_00115921 predicted 263
6 SASI_Rn01_00115922 predicted 365
7 SASI_Rn01_00115923 predicted 298
8 SASI_Rn01_00115924 predicted 637
9 SASI_Rn01_00115925 predicted 302
10 SASI_Rn01_00115926 predicted 440
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011670 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139593 predicted 393
2 SASI_Mm01_00139595 predicted 551
3 SASI_Mm01_00139596 predicted 409
4 SASI_Mm01_00139599 predicted 388
5 SASI_Mm01_00139600 predicted 553
6 SASI_Mm02_00321185 predicted 910
7 SASI_Mm01_00139601 predicted 432
8 SASI_Mm01_00139602 predicted 471
9 SASI_Mm02_00321186 predicted 902
10 SASI_Mm01_00139598 predicted 584
11 SASI_Mm01_00139594 predicted 223
12 SASI_Mm01_00139597 predicted 337
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011670
VALIDATED
UCHL1 MISSION shRNA Bacterial Glycerol Stock
ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase)
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008443    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011670.1-773s1c1
Sequence:CCGGGCTGTCTTCTTGCGTTCTACACTCGAGTGTAGAACGCAAGAAGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011670.1-44s1c1
Sequence:CCGGGCTGAACAAAGTGTTGGCCAACTCGAGTTGGCCAACACTTTGTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011670.1-471s1c1
Sequence:CCGGGATGACAAAGTGAATTTCCATCTCGAGATGGAAATTCACTTTGTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011670.1-385s1c1
Sequence:CCGGCCGAAGATAGAGCCAAGTGTTCTCGAGAACACTTGGCTCTATCTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011670.1-251s1c1
Sequence:CCGGCATGAAGCAGACCATCGGAAACTCGAGTTTCCGATGGTCTGCTTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011670.2-903s21c1
Sequence:CCGGTGGTTTGCAGCTTTAGCACTTCTCGAGAAGTGCTAAAGCTGCAAACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011670.2-824s21c1
Sequence:CCGGCTCTGCAAAGCAGCTTAAGTCCTCGAGGACTTAAGCTGCTTTGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011670.2-471s21c1
Sequence:CCGGACAACCAAGACAAGCTGGAATCTCGAGATTCCAGCTTGTCTTGGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011670.2-384s21c1
Sequence:CCGGGACAGGAAGTTAGCCCTAAAGCTCGAGCTTTAGGGCTAACTTCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011670.2-501s21c1
Sequence:CCGGGATCCGTCCTGAAACAGTTTCCTCGAGGAAACTGTTTCAGGACGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011670.2-700s21c1
Sequence:CCGGGCGAATGCCCTTTCCAGTGAACTCGAGTTCACTGGAAAGGGCATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011670.2-655s21c1
Sequence:CCGGTATTCTGTTCAACAACGTGGACTCGAGTCCACGTTGTTGAACAGAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011670
VALIDATED
UCHL1 MISSION shRNA shRNA Plasmid DNA
ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase)
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008443    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011670.1-773s1c1
Sequence:CCGGGCTGTCTTCTTGCGTTCTACACTCGAGTGTAGAACGCAAGAAGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011670.1-44s1c1
Sequence:CCGGGCTGAACAAAGTGTTGGCCAACTCGAGTTGGCCAACACTTTGTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011670.1-471s1c1
Sequence:CCGGGATGACAAAGTGAATTTCCATCTCGAGATGGAAATTCACTTTGTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011670.1-385s1c1
Sequence:CCGGCCGAAGATAGAGCCAAGTGTTCTCGAGAACACTTGGCTCTATCTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011670.1-251s1c1
Sequence:CCGGCATGAAGCAGACCATCGGAAACTCGAGTTTCCGATGGTCTGCTTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011670.2-903s21c1
Sequence:CCGGTGGTTTGCAGCTTTAGCACTTCTCGAGAAGTGCTAAAGCTGCAAACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011670.2-824s21c1
Sequence:CCGGCTCTGCAAAGCAGCTTAAGTCCTCGAGGACTTAAGCTGCTTTGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011670.2-471s21c1
Sequence:CCGGACAACCAAGACAAGCTGGAATCTCGAGATTCCAGCTTGTCTTGGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011670.2-384s21c1
Sequence:CCGGGACAGGAAGTTAGCCCTAAAGCTCGAGCTTTAGGGCTAACTTCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011670.2-501s21c1
Sequence:CCGGGATCCGTCCTGAAACAGTTTCCTCGAGGAAACTGTTTCAGGACGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011670.2-700s21c1
Sequence:CCGGGCGAATGCCCTTTCCAGTGAACTCGAGTTCACTGGAAAGGGCATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011670.2-655s21c1
Sequence:CCGGTATTCTGTTCAACAACGTGGACTCGAGTCCACGTTGTTGAACAGAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011670
VALIDATED
UCHL1 MISSION shRNA Lentiviral Transduction Particles
ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase)
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008443    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011670.1-773s1c1
Sequence:CCGGGCTGTCTTCTTGCGTTCTACACTCGAGTGTAGAACGCAAGAAGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011670.1-44s1c1
Sequence:CCGGGCTGAACAAAGTGTTGGCCAACTCGAGTTGGCCAACACTTTGTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011670.1-471s1c1
Sequence:CCGGGATGACAAAGTGAATTTCCATCTCGAGATGGAAATTCACTTTGTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011670.1-385s1c1
Sequence:CCGGCCGAAGATAGAGCCAAGTGTTCTCGAGAACACTTGGCTCTATCTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011670.1-251s1c1
Sequence:CCGGCATGAAGCAGACCATCGGAAACTCGAGTTTCCGATGGTCTGCTTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011670.2-903s21c1
Sequence:CCGGTGGTTTGCAGCTTTAGCACTTCTCGAGAAGTGCTAAAGCTGCAAACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011670.2-824s21c1
Sequence:CCGGCTCTGCAAAGCAGCTTAAGTCCTCGAGGACTTAAGCTGCTTTGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011670.2-471s21c1
Sequence:CCGGACAACCAAGACAAGCTGGAATCTCGAGATTCCAGCTTGTCTTGGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011670.2-384s21c1
Sequence:CCGGGACAGGAAGTTAGCCCTAAAGCTCGAGCTTTAGGGCTAACTTCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011670.2-501s21c1
Sequence:CCGGGATCCGTCCTGAAACAGTTTCCTCGAGGAAACTGTTTCAGGACGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011670.2-700s21c1
Sequence:CCGGGCGAATGCCCTTTCCAGTGAACTCGAGTTCACTGGAAAGGGCATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011670.2-655s21c1
Sequence:CCGGTATTCTGTTCAACAACGTGGACTCGAGTCCACGTTGTTGAACAGAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004181
VALIDATED
UCHL1 MISSION shRNA Bacterial Glycerol Stock
ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004181.3-236s1c1
Sequence:CCGGCCAGCATGAGAACTTCAGGAACTCGAGTTCCTGAAGTTCTCATGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_004181.3-332s1c1
Sequence:CCGGCTGTGGCACAATCGGACTTATCTCGAGATAAGTCCGATTGTGCCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004181.3-522s1c1
Sequence:CCGGCGGGTAGATGACAAGGTGAATCTCGAGATTCACCTTGTCATCTACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007273    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004181.3-933s1c1
Sequence:CCGGGTGTGAGCTTCAGATGGTGAACTCGAGTTCACCATCTGAAGCTCACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004181.3-400s1c1
Sequence:CCGGCAGTTCTGAAACAGTTTCTTTCTCGAGAAAGAAACTGTTTCAGAACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004181.3-236s21c1
Sequence:CCGGCCAGCATGAGAACTTCAGGAACTCGAGTTCCTGAAGTTCTCATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349548    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004181.3-933s21c1
Sequence:CCGGGTGTGAGCTTCAGATGGTGAACTCGAGTTCACCATCTGAAGCTCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004181.3-522s21c1
Sequence:CCGGCGGGTAGATGACAAGGTGAATCTCGAGATTCACCTTGTCATCTACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004181.3-400s21c1
Sequence:CCGGCAGTTCTGAAACAGTTTCTTTCTCGAGAAAGAAACTGTTTCAGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004181
VALIDATED
UCHL1 MISSION shRNA shRNA Plasmid DNA
ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004181.3-236s1c1
Sequence:CCGGCCAGCATGAGAACTTCAGGAACTCGAGTTCCTGAAGTTCTCATGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_004181.3-332s1c1
Sequence:CCGGCTGTGGCACAATCGGACTTATCTCGAGATAAGTCCGATTGTGCCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004181.3-522s1c1
Sequence:CCGGCGGGTAGATGACAAGGTGAATCTCGAGATTCACCTTGTCATCTACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007273    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004181.3-933s1c1
Sequence:CCGGGTGTGAGCTTCAGATGGTGAACTCGAGTTCACCATCTGAAGCTCACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004181.3-400s1c1
Sequence:CCGGCAGTTCTGAAACAGTTTCTTTCTCGAGAAAGAAACTGTTTCAGAACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004181.3-236s21c1
Sequence:CCGGCCAGCATGAGAACTTCAGGAACTCGAGTTCCTGAAGTTCTCATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349548    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004181.3-933s21c1
Sequence:CCGGGTGTGAGCTTCAGATGGTGAACTCGAGTTCACCATCTGAAGCTCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004181.3-522s21c1
Sequence:CCGGCGGGTAGATGACAAGGTGAATCTCGAGATTCACCTTGTCATCTACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004181.3-400s21c1
Sequence:CCGGCAGTTCTGAAACAGTTTCTTTCTCGAGAAAGAAACTGTTTCAGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004181
VALIDATED
UCHL1 MISSION shRNA Lentiviral Transduction Particles
ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004181.3-236s1c1
Sequence:CCGGCCAGCATGAGAACTTCAGGAACTCGAGTTCCTGAAGTTCTCATGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_004181.3-332s1c1
Sequence:CCGGCTGTGGCACAATCGGACTTATCTCGAGATAAGTCCGATTGTGCCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004181.3-522s1c1
Sequence:CCGGCGGGTAGATGACAAGGTGAATCTCGAGATTCACCTTGTCATCTACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007273    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004181.3-933s1c1
Sequence:CCGGGTGTGAGCTTCAGATGGTGAACTCGAGTTCACCATCTGAAGCTCACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004181.3-400s1c1
Sequence:CCGGCAGTTCTGAAACAGTTTCTTTCTCGAGAAAGAAACTGTTTCAGAACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004181.3-236s21c1
Sequence:CCGGCCAGCATGAGAACTTCAGGAACTCGAGTTCCTGAAGTTCTCATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349548    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004181.3-933s21c1
Sequence:CCGGGTGTGAGCTTCAGATGGTGAACTCGAGTTCACCATCTGAAGCTCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004181.3-522s21c1
Sequence:CCGGCGGGTAGATGACAAGGTGAATCTCGAGATTCACCTTGTCATCTACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004181.3-400s21c1
Sequence:CCGGCAGTTCTGAAACAGTTTCTTTCTCGAGAAAGAAACTGTTTCAGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks