EMAIL THIS PAGE TO A FRIEND

UCHL3

ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase)

Synonyms: UCH-L3
UniProtKB ID: P15374, B2R970, Q5TBK8, Q6IBE9
Gene ID:
Human(7347) Summary: The protein encoded by this gene is a member of the deubiquitinating enzyme family. Members of this family are proteases that catalyze the removal of ubiquitin from polypeptides and are divided into five classes, depending on the mechanism of catalysis. This protein may hydrolyze the ubiquitinyl-N-epsilon amide bond of ubiquitinated proteins to regenerate ubiquitin for another catalytic cycle. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012]
Mouse(50933) ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase)
Rat(498560) ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase)
cow(520170) ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase)
sheep(101123568) ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase)
domestic guinea pig(100728179) ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase)
naked mole-rat(101718538) ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase)
Zebrafish(554104) ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase)
chicken(395626) ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase)
dog(476947) ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase)
domestic cat(101083135) ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase)
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1767 Human UCH-L3 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006002 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006002 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006002 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016723 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016723 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016723 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU204091 MISSION® esiRNA esiRNA targeting mouse Uchl3 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006002 Rosetta Predictions human pricing
NM_001110165 Rosetta Predictions rat pricing
NM_016723 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006002 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200423 predicted 319
2 SASI_Hs01_00200424 predicted 557
3 SASI_Hs01_00200425 predicted 365
4 SASI_Hs01_00200426 predicted 353
5 SASI_Hs01_00200427 predicted 500
6 SASI_Hs01_00200428 predicted 417
7 SASI_Hs01_00200429 predicted 425
8 SASI_Hs02_00340707 predicted 612
9 SASI_Hs01_00200430 predicted 330
10 SASI_Hs01_00200431 predicted 273
11 SASI_Hs01_00200432 predicted 308
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110165 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251092 predicted 478
2 SASI_Rn02_00251093 predicted 412
3 SASI_Rn02_00251094 predicted 482
4 SASI_Rn02_00251095 predicted 492
5 SASI_Rn02_00251096 predicted 406
6 SASI_Rn02_00251097 predicted 412
7 SASI_Rn02_00251098 predicted 492
8 SASI_Rn02_00251099 predicted 451
9 SASI_Rn02_00251100 predicted 455
10 SASI_Rn02_00251101 predicted 486
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016723 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146441 predicted 415
2 SASI_Mm02_00323430 predicted 698
3 SASI_Mm02_00323431 predicted 705
4 SASI_Mm01_00146443 predicted 215
5 SASI_Mm01_00146442 predicted 286
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006002
VALIDATED
UCHL3 MISSION shRNA Bacterial Glycerol Stock
ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000320753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_006002.3-184s21c1
Sequence:CCGGGTCTTACTTCTCTTTCCTATTCTCGAGAATAGGAAAGAGAAGTAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006002.3-396s21c1
Sequence:CCGGCCTGGAGGAATCTGTGTCAATCTCGAGATTGACACAGATTCCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320757    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006002.3-724s21c1
Sequence:CCGGCTTGTCAATAATGGAAACACCCTCGAGGGTGTTTCCATTATTGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006002.3-678s21c1
Sequence:CCGGCCCTGATGAACTAAGATTTAACTCGAGTTAAATCTTAGTTCATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_006002.3-505s21c1
Sequence:CCGGGCACCAAGTATAGATGAGAAACTCGAGTTTCTCATCTATACTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006002.3-727s1c1
Sequence:CCGGGTCAATAATGGAAACACCAAACTCGAGTTTGGTGTTTCCATTATTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006002.3-184s1c1
Sequence:CCGGGTCTTACTTCTCTTTCCTATTCTCGAGAATAGGAAAGAGAAGTAAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_006002.3-505s1c1
Sequence:CCGGGCACCAAGTATAGATGAGAAACTCGAGTTTCTCATCTATACTTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006002.3-678s1c1
Sequence:CCGGCCCTGATGAACTAAGATTTAACTCGAGTTAAATCTTAGTTCATCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_006002.3-396s1c1
Sequence:CCGGCCTGGAGGAATCTGTGTCAATCTCGAGATTGACACAGATTCCTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006002
VALIDATED
UCHL3 MISSION shRNA shRNA Plasmid DNA
ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000320753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_006002.3-184s21c1
Sequence:CCGGGTCTTACTTCTCTTTCCTATTCTCGAGAATAGGAAAGAGAAGTAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006002.3-396s21c1
Sequence:CCGGCCTGGAGGAATCTGTGTCAATCTCGAGATTGACACAGATTCCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320757    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006002.3-724s21c1
Sequence:CCGGCTTGTCAATAATGGAAACACCCTCGAGGGTGTTTCCATTATTGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006002.3-678s21c1
Sequence:CCGGCCCTGATGAACTAAGATTTAACTCGAGTTAAATCTTAGTTCATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_006002.3-505s21c1
Sequence:CCGGGCACCAAGTATAGATGAGAAACTCGAGTTTCTCATCTATACTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006002.3-727s1c1
Sequence:CCGGGTCAATAATGGAAACACCAAACTCGAGTTTGGTGTTTCCATTATTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006002.3-184s1c1
Sequence:CCGGGTCTTACTTCTCTTTCCTATTCTCGAGAATAGGAAAGAGAAGTAAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_006002.3-505s1c1
Sequence:CCGGGCACCAAGTATAGATGAGAAACTCGAGTTTCTCATCTATACTTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006002.3-678s1c1
Sequence:CCGGCCCTGATGAACTAAGATTTAACTCGAGTTAAATCTTAGTTCATCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_006002.3-396s1c1
Sequence:CCGGCCTGGAGGAATCTGTGTCAATCTCGAGATTGACACAGATTCCTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006002
VALIDATED
UCHL3 MISSION shRNA Lentiviral Transduction Particles
ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000320753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_006002.3-184s21c1
Sequence:CCGGGTCTTACTTCTCTTTCCTATTCTCGAGAATAGGAAAGAGAAGTAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006002.3-396s21c1
Sequence:CCGGCCTGGAGGAATCTGTGTCAATCTCGAGATTGACACAGATTCCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320757    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006002.3-724s21c1
Sequence:CCGGCTTGTCAATAATGGAAACACCCTCGAGGGTGTTTCCATTATTGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006002.3-678s21c1
Sequence:CCGGCCCTGATGAACTAAGATTTAACTCGAGTTAAATCTTAGTTCATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_006002.3-505s21c1
Sequence:CCGGGCACCAAGTATAGATGAGAAACTCGAGTTTCTCATCTATACTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006002.3-727s1c1
Sequence:CCGGGTCAATAATGGAAACACCAAACTCGAGTTTGGTGTTTCCATTATTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006002.3-184s1c1
Sequence:CCGGGTCTTACTTCTCTTTCCTATTCTCGAGAATAGGAAAGAGAAGTAAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_006002.3-505s1c1
Sequence:CCGGGCACCAAGTATAGATGAGAAACTCGAGTTTCTCATCTATACTTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006002.3-678s1c1
Sequence:CCGGCCCTGATGAACTAAGATTTAACTCGAGTTAAATCTTAGTTCATCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_006002.3-396s1c1
Sequence:CCGGCCTGGAGGAATCTGTGTCAATCTCGAGATTGACACAGATTCCTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016723
VALIDATED
UCHL3 MISSION shRNA Bacterial Glycerol Stock
ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030714    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016723.1-703s1c1
Sequence:CCGGTCTTGACAGAAACACCAAATACTCGAGTATTTGGTGTTTCTGTCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016723.1-655s1c1
Sequence:CCGGCCCTGATGAGTTAAGATTTAACTCGAGTTAAATCTTAACTCATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016723.1-135s1c1
Sequence:CCGGGCATGGTACCAAGACCAGTATCTCGAGATACTGGTCTTGGTACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016723.1-288s1c1
Sequence:CCGGCCTGTGGAACGATTGGACTAACTCGAGTTAGTCCAATCGTTCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016723.1-122s1c1
Sequence:CCGGCCTGAACTTCTTAGCATGGTACTCGAGTACCATGCTAAGAAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016723
VALIDATED
UCHL3 MISSION shRNA shRNA Plasmid DNA
ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030714    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016723.1-703s1c1
Sequence:CCGGTCTTGACAGAAACACCAAATACTCGAGTATTTGGTGTTTCTGTCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016723.1-655s1c1
Sequence:CCGGCCCTGATGAGTTAAGATTTAACTCGAGTTAAATCTTAACTCATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016723.1-135s1c1
Sequence:CCGGGCATGGTACCAAGACCAGTATCTCGAGATACTGGTCTTGGTACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016723.1-288s1c1
Sequence:CCGGCCTGTGGAACGATTGGACTAACTCGAGTTAGTCCAATCGTTCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016723.1-122s1c1
Sequence:CCGGCCTGAACTTCTTAGCATGGTACTCGAGTACCATGCTAAGAAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016723
VALIDATED
UCHL3 MISSION shRNA Lentiviral Transduction Particles
ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030714    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016723.1-703s1c1
Sequence:CCGGTCTTGACAGAAACACCAAATACTCGAGTATTTGGTGTTTCTGTCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016723.1-655s1c1
Sequence:CCGGCCCTGATGAGTTAAGATTTAACTCGAGTTAAATCTTAACTCATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016723.1-135s1c1
Sequence:CCGGGCATGGTACCAAGACCAGTATCTCGAGATACTGGTCTTGGTACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016723.1-288s1c1
Sequence:CCGGCCTGTGGAACGATTGGACTAACTCGAGTTAGTCCAATCGTTCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016723.1-122s1c1
Sequence:CCGGCCTGAACTTCTTAGCATGGTACTCGAGTACCATGCTAAGAAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks