EMAIL THIS PAGE TO A FRIEND

UCHL5

ubiquitin carboxyl-terminal hydrolase L5

Synonyms: CGI-70 INO80R UCH-L5 UCH37
Gene ID:
Mouse(56207) ubiquitin carboxyl-terminal esterase L5
Rat(360853) ubiquitin carboxyl-terminal hydrolase L5
cow(282110) ubiquitin carboxyl-terminal hydrolase L5
sheep(101121952) ubiquitin carboxyl-terminal hydrolase L5
domestic guinea pig(100735571) ubiquitin carboxyl-terminal hydrolase L5
naked mole-rat(101696695) ubiquitin carboxyl-terminal hydrolase L5
Domestic Rabbit(100349016) ubiquitin carboxyl-terminal hydrolase L5
Zebrafish(406357) ubiquitin carboxyl-terminal hydrolase L5
dog(478958) ubiquitin carboxyl-terminal hydrolase L5
chicken(424359) ubiquitin carboxyl-terminal hydrolase L5
142 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019562 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019562 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019562 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015984 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015984 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015984 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015984 Rosetta Predictions human pricing
NM_001012149 Rosetta Predictions rat pricing
XM_573467 Rosetta Predictions rat pricing
NM_019562 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015984 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142742 predicted 621
2 SASI_Hs01_00142743 predicted 991
3 SASI_Hs01_00142744 predicted 546
4 SASI_Hs01_00142745 predicted 788
5 SASI_Hs01_00142746 predicted 522
6 SASI_Hs01_00142747 predicted 872
7 SASI_Hs01_00142748 predicted 1188
8 SASI_Hs01_00142749 predicted 1054
9 SASI_Hs01_00142750 predicted 839
10 SASI_Hs02_00348658 predicted 1027
11 SASI_Hs01_00142741 predicted 1103
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012149 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200327 predicted 721
2 SASI_Rn01_00088212 predicted 874
3 SASI_Rn02_00200328 predicted 1140
4 SASI_Rn01_00088213 predicted 579
5 SASI_Rn01_00088214 predicted 584
6 SASI_Rn01_00088215 predicted 518
7 SASI_Rn01_00088217 predicted 619
8 SASI_Rn01_00088218 predicted 625
9 SASI_Rn01_00088219 predicted 826
10 SASI_Rn01_00088221 predicted 845
11 SASI_Rn01_00088216 predicted 294
12 SASI_Rn01_00088220 predicted 1090
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573467 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00191416 predicted 1389
2 SASI_Rn01_00191417 predicted 759
3 SASI_Rn01_00191418 predicted 1408
4 SASI_Rn01_00191419 predicted 1261
5 SASI_Rn01_00191420 predicted 745
6 SASI_Rn01_00191421 predicted 760
7 SASI_Rn01_00191422 predicted 1256
8 SASI_Rn01_00191423 predicted 1442
9 SASI_Rn01_00191424 predicted 1411
10 SASI_Rn01_00191425 predicted 1327
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019562 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094553 predicted 604
2 SASI_Mm02_00324597 predicted 707
3 SASI_Mm01_00094555 predicted 851
4 SASI_Mm01_00094556 predicted 825
5 SASI_Mm01_00094557 predicted 569
6 SASI_Mm01_00094558 predicted 505
7 SASI_Mm01_00094559 predicted 273
8 SASI_Mm01_00094560 predicted 586
9 SASI_Mm01_00094561 predicted 557
10 SASI_Mm02_00324598 predicted 769
11 SASI_Mm01_00094552 predicted 708
12 SASI_Mm01_00094554 predicted 860
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019562
UCHL5 MISSION shRNA Bacterial Glycerol Stock
ubiquitin carboxyl-terminal hydrolase L5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019562.1-806s1c1
Sequence:CCGGCCATGGATACAGATCAAGGTACTCGAGTACCTTGATCTGTATCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019562.1-638s1c1
Sequence:CCGGGCAATCAAGATGACTGGATTACTCGAGTAATCCAGTCATCTTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019562.1-206s1c1
Sequence:CCGGAGCCAGTTCATGGGTTAATTTCTCGAGAAATTAACCCATGAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019562.1-942s1c1
Sequence:CCGGCTTGCCTTTCATTATGGAATTCTCGAGAATTCCATAATGAAAGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019562.1-365s1c1
Sequence:CCGGGTACGCATCAAGATGTGCATTCTCGAGAATGCACATCTTGATGCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019562.1-365s21c1
Sequence:CCGGGTACGCATCAAGATGTGCATTCTCGAGAATGCACATCTTGATGCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019562.1-638s21c1
Sequence:CCGGGCAATCAAGATGACTGGATTACTCGAGTAATCCAGTCATCTTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019562.1-806s21c1
Sequence:CCGGCCATGGATACAGATCAAGGTACTCGAGTACCTTGATCTGTATCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019562.1-942s21c1
Sequence:CCGGCTTGCCTTTCATTATGGAATTCTCGAGAATTCCATAATGAAAGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019562.1-206s21c1
Sequence:CCGGAGCCAGTTCATGGGTTAATTTCTCGAGAAATTAACCCATGAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019562
UCHL5 MISSION shRNA shRNA Plasmid DNA
ubiquitin carboxyl-terminal hydrolase L5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019562.1-806s1c1
Sequence:CCGGCCATGGATACAGATCAAGGTACTCGAGTACCTTGATCTGTATCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019562.1-638s1c1
Sequence:CCGGGCAATCAAGATGACTGGATTACTCGAGTAATCCAGTCATCTTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019562.1-206s1c1
Sequence:CCGGAGCCAGTTCATGGGTTAATTTCTCGAGAAATTAACCCATGAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019562.1-942s1c1
Sequence:CCGGCTTGCCTTTCATTATGGAATTCTCGAGAATTCCATAATGAAAGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019562.1-365s1c1
Sequence:CCGGGTACGCATCAAGATGTGCATTCTCGAGAATGCACATCTTGATGCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019562.1-365s21c1
Sequence:CCGGGTACGCATCAAGATGTGCATTCTCGAGAATGCACATCTTGATGCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019562.1-638s21c1
Sequence:CCGGGCAATCAAGATGACTGGATTACTCGAGTAATCCAGTCATCTTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019562.1-806s21c1
Sequence:CCGGCCATGGATACAGATCAAGGTACTCGAGTACCTTGATCTGTATCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019562.1-942s21c1
Sequence:CCGGCTTGCCTTTCATTATGGAATTCTCGAGAATTCCATAATGAAAGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019562.1-206s21c1
Sequence:CCGGAGCCAGTTCATGGGTTAATTTCTCGAGAAATTAACCCATGAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019562
UCHL5 MISSION shRNA Lentiviral Transduction Particles
ubiquitin carboxyl-terminal hydrolase L5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019562.1-806s1c1
Sequence:CCGGCCATGGATACAGATCAAGGTACTCGAGTACCTTGATCTGTATCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019562.1-638s1c1
Sequence:CCGGGCAATCAAGATGACTGGATTACTCGAGTAATCCAGTCATCTTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019562.1-206s1c1
Sequence:CCGGAGCCAGTTCATGGGTTAATTTCTCGAGAAATTAACCCATGAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019562.1-942s1c1
Sequence:CCGGCTTGCCTTTCATTATGGAATTCTCGAGAATTCCATAATGAAAGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019562.1-365s1c1
Sequence:CCGGGTACGCATCAAGATGTGCATTCTCGAGAATGCACATCTTGATGCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019562.1-365s21c1
Sequence:CCGGGTACGCATCAAGATGTGCATTCTCGAGAATGCACATCTTGATGCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019562.1-638s21c1
Sequence:CCGGGCAATCAAGATGACTGGATTACTCGAGTAATCCAGTCATCTTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019562.1-806s21c1
Sequence:CCGGCCATGGATACAGATCAAGGTACTCGAGTACCTTGATCTGTATCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019562.1-942s21c1
Sequence:CCGGCTTGCCTTTCATTATGGAATTCTCGAGAATTCCATAATGAAAGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019562.1-206s21c1
Sequence:CCGGAGCCAGTTCATGGGTTAATTTCTCGAGAAATTAACCCATGAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015984
VALIDATED
UCHL5 MISSION shRNA Bacterial Glycerol Stock
ubiquitin carboxyl-terminal hydrolase L5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015984.x-345s1c1
Sequence:CCGGTCCCGACTTGACACGATATTTCTCGAGAAATATCGTGTCAAGTCGGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015984.x-639s1c1
Sequence:CCGGCCTGTTAATGGGAGACTGTATCTCGAGATACAGTCTCCCATTAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004128    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015984.x-1246s1c1
Sequence:CCGGTCTTGTCTTTAATGCATGGATCTCGAGATCCATGCATTAAAGACAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015984.x-190s1c1
Sequence:CCGGAGCTCATTAAAGGATTCGGTTCTCGAGAACCGAATCCTTTAATGAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015984.x-1093s1c1
Sequence:CCGGACGCAAAGAAAGCTCAGGAAACTCGAGTTTCCTGAGCTTTCTTTGCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234909    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015984.2-1385s21c1
Sequence:CCGGCTGGTTGTCTAACTACCATATCTCGAGATATGGTAGTTAGACAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015984.2-345s21c1
Sequence:CCGGTCCCGACTTGACACGATATTTCTCGAGAAATATCGTGTCAAGTCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015984.2-271s21c1
Sequence:CCGGAGCCAGTTCATGGGTTAATTTCTCGAGAAATTAACCCATGAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015984.2-178s21c1
Sequence:CCGGGGGTCTTCACCGAGCTCATTACTCGAGTAATGAGCTCGGTGAAGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015984.2-767s21c1
Sequence:CCGGTGAAGGTGAAATTCGATTTAACTCGAGTTAAATCGAATTTCACCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015984
VALIDATED
UCHL5 MISSION shRNA shRNA Plasmid DNA
ubiquitin carboxyl-terminal hydrolase L5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015984.x-345s1c1
Sequence:CCGGTCCCGACTTGACACGATATTTCTCGAGAAATATCGTGTCAAGTCGGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015984.x-639s1c1
Sequence:CCGGCCTGTTAATGGGAGACTGTATCTCGAGATACAGTCTCCCATTAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004128    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015984.x-1246s1c1
Sequence:CCGGTCTTGTCTTTAATGCATGGATCTCGAGATCCATGCATTAAAGACAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015984.x-190s1c1
Sequence:CCGGAGCTCATTAAAGGATTCGGTTCTCGAGAACCGAATCCTTTAATGAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015984.x-1093s1c1
Sequence:CCGGACGCAAAGAAAGCTCAGGAAACTCGAGTTTCCTGAGCTTTCTTTGCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234909    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015984.2-1385s21c1
Sequence:CCGGCTGGTTGTCTAACTACCATATCTCGAGATATGGTAGTTAGACAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015984.2-345s21c1
Sequence:CCGGTCCCGACTTGACACGATATTTCTCGAGAAATATCGTGTCAAGTCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015984.2-271s21c1
Sequence:CCGGAGCCAGTTCATGGGTTAATTTCTCGAGAAATTAACCCATGAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015984.2-178s21c1
Sequence:CCGGGGGTCTTCACCGAGCTCATTACTCGAGTAATGAGCTCGGTGAAGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015984.2-767s21c1
Sequence:CCGGTGAAGGTGAAATTCGATTTAACTCGAGTTAAATCGAATTTCACCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015984
VALIDATED
UCHL5 MISSION shRNA Lentiviral Transduction Particles
ubiquitin carboxyl-terminal hydrolase L5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015984.x-345s1c1
Sequence:CCGGTCCCGACTTGACACGATATTTCTCGAGAAATATCGTGTCAAGTCGGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015984.x-639s1c1
Sequence:CCGGCCTGTTAATGGGAGACTGTATCTCGAGATACAGTCTCCCATTAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004128    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015984.x-1246s1c1
Sequence:CCGGTCTTGTCTTTAATGCATGGATCTCGAGATCCATGCATTAAAGACAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015984.x-190s1c1
Sequence:CCGGAGCTCATTAAAGGATTCGGTTCTCGAGAACCGAATCCTTTAATGAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015984.x-1093s1c1
Sequence:CCGGACGCAAAGAAAGCTCAGGAAACTCGAGTTTCCTGAGCTTTCTTTGCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234909    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015984.2-1385s21c1
Sequence:CCGGCTGGTTGTCTAACTACCATATCTCGAGATATGGTAGTTAGACAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015984.2-345s21c1
Sequence:CCGGTCCCGACTTGACACGATATTTCTCGAGAAATATCGTGTCAAGTCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015984.2-271s21c1
Sequence:CCGGAGCCAGTTCATGGGTTAATTTCTCGAGAAATTAACCCATGAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015984.2-178s21c1
Sequence:CCGGGGGTCTTCACCGAGCTCATTACTCGAGTAATGAGCTCGGTGAAGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015984.2-767s21c1
Sequence:CCGGTGAAGGTGAAATTCGATTTAACTCGAGTTAAATCGAATTTCACCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks