EMAIL THIS PAGE TO A FRIEND

UCK1

uridine-cytidine kinase 1

Synonyms: URK1
UniProtKB ID: Q9HA47, Q5JT10, Q5JT12, Q5JT13, Q6IA74, Q96BJ0
Gene ID:
Human(83549) Summary: This gene encodes a uridine-cytidine kinase that catalyzes the phosphorylation of uridine and cytidine to uridine monophosphate (UMP) and cytidine monophosphate (CMP) but not the phosphorylation of deoxyribonucleosides or purine ribonucleosides. This enzyme can also phosphorylate uridine and cytidine analogs and uses both ATP and GTP as a phosphate donor. Alternative splicing results in multiple splice variants encoding distinct isoforms. [provided by RefSeq, May 2012]
Mouse(22245) uridine-cytidine kinase 1
Rat(311864) uridine-cytidine kinase 1
cow(519697) uridine-cytidine kinase 1
sheep(101121416) uridine-cytidine kinase 1
naked mole-rat(101720074) uridine-cytidine kinase 1
domestic guinea pig(100728243) uridine-cytidine kinase 1
Zebrafish(447928) uridine-cytidine kinase 1
chicken(771901) uridine-cytidine kinase 1
dog(608503) uridine-cytidine kinase 1
domestic cat(101099253) uridine-cytidine kinase 1
70 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031432 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031432 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031432 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011675 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011675 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011675 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU012781 MISSION® esiRNA esiRNA targeting mouse Uck1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031432 Rosetta Predictions human pricing
NM_001107831 Rosetta Predictions rat pricing
NM_011675 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031432 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358841 predicted 358
2 SASI_Hs01_00016276 predicted 457
3 SASI_Hs01_00016277 predicted 322
4 SASI_Hs01_00016279 predicted 829
5 SASI_Hs01_00016280 predicted 675
6 SASI_Hs02_00358842 predicted 890
7 SASI_Hs01_00016283 predicted 883
8 SASI_Hs01_00016284 predicted 774
9 SASI_Hs02_00358843 predicted 640
10 SASI_Hs02_00358844 predicted 396
11 SASI_Hs01_00016275 predicted 350
12 SASI_Hs01_00016278 predicted 506
13 SASI_Hs01_00016281 predicted 493
14 SASI_Hs01_00016282 predicted 363
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107831 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232705 predicted 637
2 SASI_Rn02_00232706 predicted 324
3 SASI_Rn02_00232707 predicted 453
4 SASI_Rn02_00232708 predicted 561
5 SASI_Rn02_00232709 predicted 1045
6 SASI_Rn02_00232710 predicted 634
7 SASI_Rn02_00232711 predicted 625
8 SASI_Rn02_00232712 predicted 1069
9 SASI_Rn02_00232713 predicted 200
10 SASI_Rn02_00232714 predicted 479
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011675 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108220 predicted 1155
2 SASI_Mm01_00108221 predicted 1281
3 SASI_Mm02_00321203 predicted 535
4 SASI_Mm02_00321204 predicted 642
5 SASI_Mm01_00108222 predicted 603
6 SASI_Mm02_00321205 predicted 257
7 SASI_Mm01_00108223 predicted 607
8 SASI_Mm01_00108225 predicted 968
9 SASI_Mm01_00108227 predicted 1157
10 SASI_Mm01_00108228 predicted 1281
11 SASI_Mm01_00108224 predicted 1015
12 SASI_Mm01_00108226 predicted 1289
13 SASI_Mm01_00108229 predicted 1075
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031432
VALIDATED
UCK1 MISSION shRNA Bacterial Glycerol Stock
uridine-cytidine kinase 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031432.2-691s21c1
Sequence:CCGGAGTTCTGCCTGCCGACAAAGACTCGAGTCTTTGTCGGCAGGCAGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031432.2-431s21c1
Sequence:CCGGGGAGGTGCCGACCTATGATTTCTCGAGAAATCATAGGTCGGCACCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031432.2-656s21c1
Sequence:CCGGGCAGTACACCACCTTCGTGAACTCGAGTTCACGAAGGTGGTGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031432.1-329s1c1
Sequence:CCGGGCCTTGAAAGGACAGTACAATCTCGAGATTGTACTGTCCTTTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031432.1-728s1c1
Sequence:CCGGCGAGGAGTGGACAATATGGTTCTCGAGAACCATATTGTCCACTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031432.1-882s1c1
Sequence:CCGGCCTCTGGCAAACGGTCACATTCTCGAGAATGTGACCGTTTGCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031432.1-830s1c1
Sequence:CCGGCGGAGCTACAAGCGGACCTTTCTCGAGAAAGGTCCGCTTGTAGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031432.1-208s1c1
Sequence:CCGGCGTGTGTGAGAAGATCATGGACTCGAGTCCATGATCTTCTCACACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199432    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031432.1-1871s1c1
Sequence:CCGGCAAGCCTCCTTTGTGCTATGTCTCGAGACATAGCACAAAGGAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031432.1-893s1c1
Sequence:CCGGCGGTCACATTTGGAGTCCAGCCTCGAGGCTGGACTCCAAATGTGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031432.1-485s1c1
Sequence:CCGGCCTGCGGACGTGGTTCTGTTTCTCGAGAAACAGAACCACGTCCGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031432.1-583s1c1
Sequence:CCGGCGTCAGGCTGTCTCGAAGAGTCTCGAGACTCTTCGAGACAGCCTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031432
VALIDATED
UCK1 MISSION shRNA shRNA Plasmid DNA
uridine-cytidine kinase 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031432.2-691s21c1
Sequence:CCGGAGTTCTGCCTGCCGACAAAGACTCGAGTCTTTGTCGGCAGGCAGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031432.2-431s21c1
Sequence:CCGGGGAGGTGCCGACCTATGATTTCTCGAGAAATCATAGGTCGGCACCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031432.2-656s21c1
Sequence:CCGGGCAGTACACCACCTTCGTGAACTCGAGTTCACGAAGGTGGTGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031432.1-329s1c1
Sequence:CCGGGCCTTGAAAGGACAGTACAATCTCGAGATTGTACTGTCCTTTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031432.1-728s1c1
Sequence:CCGGCGAGGAGTGGACAATATGGTTCTCGAGAACCATATTGTCCACTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031432.1-882s1c1
Sequence:CCGGCCTCTGGCAAACGGTCACATTCTCGAGAATGTGACCGTTTGCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031432.1-830s1c1
Sequence:CCGGCGGAGCTACAAGCGGACCTTTCTCGAGAAAGGTCCGCTTGTAGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031432.1-208s1c1
Sequence:CCGGCGTGTGTGAGAAGATCATGGACTCGAGTCCATGATCTTCTCACACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199432    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031432.1-1871s1c1
Sequence:CCGGCAAGCCTCCTTTGTGCTATGTCTCGAGACATAGCACAAAGGAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031432.1-893s1c1
Sequence:CCGGCGGTCACATTTGGAGTCCAGCCTCGAGGCTGGACTCCAAATGTGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031432.1-485s1c1
Sequence:CCGGCCTGCGGACGTGGTTCTGTTTCTCGAGAAACAGAACCACGTCCGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031432.1-583s1c1
Sequence:CCGGCGTCAGGCTGTCTCGAAGAGTCTCGAGACTCTTCGAGACAGCCTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031432
VALIDATED
UCK1 MISSION shRNA Lentiviral Transduction Particles
uridine-cytidine kinase 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031432.2-691s21c1
Sequence:CCGGAGTTCTGCCTGCCGACAAAGACTCGAGTCTTTGTCGGCAGGCAGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031432.2-431s21c1
Sequence:CCGGGGAGGTGCCGACCTATGATTTCTCGAGAAATCATAGGTCGGCACCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031432.2-656s21c1
Sequence:CCGGGCAGTACACCACCTTCGTGAACTCGAGTTCACGAAGGTGGTGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031432.1-329s1c1
Sequence:CCGGGCCTTGAAAGGACAGTACAATCTCGAGATTGTACTGTCCTTTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031432.1-728s1c1
Sequence:CCGGCGAGGAGTGGACAATATGGTTCTCGAGAACCATATTGTCCACTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031432.1-882s1c1
Sequence:CCGGCCTCTGGCAAACGGTCACATTCTCGAGAATGTGACCGTTTGCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031432.1-830s1c1
Sequence:CCGGCGGAGCTACAAGCGGACCTTTCTCGAGAAAGGTCCGCTTGTAGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031432.1-208s1c1
Sequence:CCGGCGTGTGTGAGAAGATCATGGACTCGAGTCCATGATCTTCTCACACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199432    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031432.1-1871s1c1
Sequence:CCGGCAAGCCTCCTTTGTGCTATGTCTCGAGACATAGCACAAAGGAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031432.1-893s1c1
Sequence:CCGGCGGTCACATTTGGAGTCCAGCCTCGAGGCTGGACTCCAAATGTGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031432.1-485s1c1
Sequence:CCGGCCTGCGGACGTGGTTCTGTTTCTCGAGAAACAGAACCACGTCCGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031432.1-583s1c1
Sequence:CCGGCGTCAGGCTGTCTCGAAGAGTCTCGAGACTCTTCGAGACAGCCTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011675
VALIDATED
UCK1 MISSION shRNA Bacterial Glycerol Stock
uridine-cytidine kinase 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011675.1-1109s21c1
Sequence:CCGGTGTCCCAAACAGCATAGTAAGCTCGAGCTTACTATGCTGTTTGGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011675.1-386s21c1
Sequence:CCGGCGAGGTCCCTACCTATGATTTCTCGAGAAATCATAGGTAGGGACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011675.1-293s21c1
Sequence:CCGGTTTGAAGGGACAGTACAATTTCTCGAGAAATTGTACTGTCCCTTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011675.1-342s21c3
Sequence:CCGGCTGATGCACAAGACCCTGAAACTCGAGTTTCAGGGTCTTGTGCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011675.1-164s21c3
Sequence:CCGGGTCAACAGTGTGTGAGAAGATCTCGAGATCTTCTCACACACTGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011675.2-1393s21c1
Sequence:CCGGTGGGCTATGGTCCAGTTTAAGCTCGAGCTTAAACTGGACCATAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011675.1-386s1c1
Sequence:CCGGCGAGGTCCCTACCTATGATTTCTCGAGAAATCATAGGTAGGGACCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011675.1-164s1c1
Sequence:CCGGGTCAACAGTGTGTGAGAAGATCTCGAGATCTTCTCACACACTGTTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011675.1-342s1c1
Sequence:CCGGCTGATGCACAAGACCCTGAAACTCGAGTTTCAGGGTCTTGTGCATCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011675.1-246s1c1
Sequence:CCGGCAGGACTGCTTCTACAAGGTTCTCGAGAACCTTGTAGAAGCAGTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011675.1-148s1c1
Sequence:CCGGGCACCGCTAGTGGCAAGTCAACTCGAGTTGACTTGCCACTAGCGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011675
VALIDATED
UCK1 MISSION shRNA shRNA Plasmid DNA
uridine-cytidine kinase 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011675.1-1109s21c1
Sequence:CCGGTGTCCCAAACAGCATAGTAAGCTCGAGCTTACTATGCTGTTTGGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011675.1-386s21c1
Sequence:CCGGCGAGGTCCCTACCTATGATTTCTCGAGAAATCATAGGTAGGGACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011675.1-293s21c1
Sequence:CCGGTTTGAAGGGACAGTACAATTTCTCGAGAAATTGTACTGTCCCTTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011675.1-342s21c3
Sequence:CCGGCTGATGCACAAGACCCTGAAACTCGAGTTTCAGGGTCTTGTGCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011675.1-164s21c3
Sequence:CCGGGTCAACAGTGTGTGAGAAGATCTCGAGATCTTCTCACACACTGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011675.2-1393s21c1
Sequence:CCGGTGGGCTATGGTCCAGTTTAAGCTCGAGCTTAAACTGGACCATAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011675.1-386s1c1
Sequence:CCGGCGAGGTCCCTACCTATGATTTCTCGAGAAATCATAGGTAGGGACCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011675.1-164s1c1
Sequence:CCGGGTCAACAGTGTGTGAGAAGATCTCGAGATCTTCTCACACACTGTTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011675.1-342s1c1
Sequence:CCGGCTGATGCACAAGACCCTGAAACTCGAGTTTCAGGGTCTTGTGCATCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011675.1-246s1c1
Sequence:CCGGCAGGACTGCTTCTACAAGGTTCTCGAGAACCTTGTAGAAGCAGTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011675.1-148s1c1
Sequence:CCGGGCACCGCTAGTGGCAAGTCAACTCGAGTTGACTTGCCACTAGCGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011675
VALIDATED
UCK1 MISSION shRNA Lentiviral Transduction Particles
uridine-cytidine kinase 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011675.1-1109s21c1
Sequence:CCGGTGTCCCAAACAGCATAGTAAGCTCGAGCTTACTATGCTGTTTGGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011675.1-386s21c1
Sequence:CCGGCGAGGTCCCTACCTATGATTTCTCGAGAAATCATAGGTAGGGACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011675.1-293s21c1
Sequence:CCGGTTTGAAGGGACAGTACAATTTCTCGAGAAATTGTACTGTCCCTTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011675.1-342s21c3
Sequence:CCGGCTGATGCACAAGACCCTGAAACTCGAGTTTCAGGGTCTTGTGCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011675.1-164s21c3
Sequence:CCGGGTCAACAGTGTGTGAGAAGATCTCGAGATCTTCTCACACACTGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011675.2-1393s21c1
Sequence:CCGGTGGGCTATGGTCCAGTTTAAGCTCGAGCTTAAACTGGACCATAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011675.1-386s1c1
Sequence:CCGGCGAGGTCCCTACCTATGATTTCTCGAGAAATCATAGGTAGGGACCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011675.1-164s1c1
Sequence:CCGGGTCAACAGTGTGTGAGAAGATCTCGAGATCTTCTCACACACTGTTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011675.1-342s1c1
Sequence:CCGGCTGATGCACAAGACCCTGAAACTCGAGTTTCAGGGTCTTGTGCATCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011675.1-246s1c1
Sequence:CCGGCAGGACTGCTTCTACAAGGTTCTCGAGAACCTTGTAGAAGCAGTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011675.1-148s1c1
Sequence:CCGGGCACCGCTAGTGGCAAGTCAACTCGAGTTGACTTGCCACTAGCGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks