EMAIL THIS PAGE TO A FRIEND

UCK2

uridine-cytidine kinase 2

Synonyms: TSA903 UK UMPK
UniProtKB ID: Q9BZX2, Q5VV91, Q7KZV3, Q92528, Q96KG5, Q9BU42
Gene ID:
Human(7371) Summary: This gene encodes a pyrimidine ribonucleoside kinase. The encoded protein (EC 2.7.1.48) catalyzes phosphorylation of uridine and cytidine to uridine monophosphate (UMP) and cytidine monophosphate (CMP), respectively.[provided by RefSeq, Oct 2010]
Mouse(80914) uridine-cytidine kinase 2
Rat(304944) uridine-cytidine kinase 2
chicken(424406) uridine-cytidine kinase 2
dog(608979) uridine-cytidine kinase 2
domestic cat(101098514) uridine-cytidine kinase 2
domestic guinea pig(100733408) uridine-cytidine kinase 2
naked mole-rat(101718657) uridine-cytidine kinase 2
cow(541028) uridine-cytidine kinase 2
sheep(101109670) uridine-cytidine kinase 2
86 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012474 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012474 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012474 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030724 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030724 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030724 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012474 Rosetta Predictions human pricing
NM_001102408 Rosetta Predictions rat pricing
NM_030724 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012474 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144157 predicted 665
2 SASI_Hs01_00144158 predicted 801
3 SASI_Hs01_00144159 predicted 434
4 SASI_Hs01_00144160 predicted 561
5 SASI_Hs01_00144161 predicted 757
6 SASI_Hs01_00144162 predicted 733
7 SASI_Hs01_00144163 predicted 740
8 SASI_Hs01_00144164 predicted 357
9 SASI_Hs01_00144165 predicted 610
10 SASI_Hs02_00344386 predicted 329
11 SASI_Hs01_00144166 predicted 880
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102408 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211444 predicted 1137
2 SASI_Rn02_00211445 predicted 1092
3 SASI_Rn02_00211446 predicted 1291
4 SASI_Rn02_00211447 predicted 1287
5 SASI_Rn02_00211448 predicted 1157
6 SASI_Rn02_00211449 predicted 824
7 SASI_Rn02_00211450 predicted 622
8 SASI_Rn02_00211451 predicted 1299
9 SASI_Rn02_00211452 predicted 705
10 SASI_Rn02_00211453 predicted 992
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030724 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098560 predicted 942
2 SASI_Mm01_00098561 predicted 829
3 SASI_Mm01_00098562 predicted 806
4 SASI_Mm01_00098563 predicted 426
5 SASI_Mm01_00098564 predicted 1111
6 SASI_Mm01_00098565 predicted 712
7 SASI_Mm01_00098566 predicted 680
8 SASI_Mm01_00098567 predicted 796
9 SASI_Mm02_00336912 predicted 735
10 SASI_Mm01_00098569 predicted 508
11 SASI_Mm01_00098568 predicted 482
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012474
UCK2 MISSION shRNA Bacterial Glycerol Stock
uridine-cytidine kinase 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012474.3-566s1c1
Sequence:CCGGGCAGACGTGGTGCTCTTTGAACTCGAGTTCAAAGAGCACCACGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196976    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012474.3-514s1c1
Sequence:CCGGGTATGACTTTGTCTCCCATTCCTCGAGGAATGGGAGACAAAGTCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194787    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012474.3-1032s1c1
Sequence:CCGGCATCTGTACATACTGTTTCCTCTCGAGAGGAAACAGTATGTACAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195034    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012474.3-444s1c1
Sequence:CCGGCCTTTGACAATGAACTCATTCCTCGAGGAATGAGTTCATTGTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012474.3-705s1c1
Sequence:CCGGGCAGGGATCTTGAGCAGATTTCTCGAGAAATCTGCTCAAGATCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012474.3-475s1c1
Sequence:CCGGCAAAGAAATCACTGAAGGGAACTCGAGTTCCCTTCAGTGATTTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012474.3-542s1c1
Sequence:CCGGGAGGAGACAGTTACTGTCTATCTCGAGATAGACAGTAACTGTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012474.3-889s1c1
Sequence:CCGGGCAGACCAATGGCTGTCTCAACTCGAGTTGAGACAGCCATTGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012474.3-365s1c1
Sequence:CCGGGATAGCTTCTACCGTGTCCTTCTCGAGAAGGACACGGTAGAAGCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012474.3-666s21c1
Sequence:GTACCGGGGCTCTCACGCAGAGTATTAACTCGAGTTAATACTCTGCGTGAGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012474.3-1041s21c1
Sequence:GTACCGGATACTGTTTCCTATGACATTACTCGAGTAATGTCATAGGAAACAGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012474
UCK2 MISSION shRNA shRNA Plasmid DNA
uridine-cytidine kinase 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012474.3-566s1c1
Sequence:CCGGGCAGACGTGGTGCTCTTTGAACTCGAGTTCAAAGAGCACCACGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196976    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012474.3-514s1c1
Sequence:CCGGGTATGACTTTGTCTCCCATTCCTCGAGGAATGGGAGACAAAGTCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194787    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012474.3-1032s1c1
Sequence:CCGGCATCTGTACATACTGTTTCCTCTCGAGAGGAAACAGTATGTACAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195034    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012474.3-444s1c1
Sequence:CCGGCCTTTGACAATGAACTCATTCCTCGAGGAATGAGTTCATTGTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012474.3-705s1c1
Sequence:CCGGGCAGGGATCTTGAGCAGATTTCTCGAGAAATCTGCTCAAGATCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012474.3-475s1c1
Sequence:CCGGCAAAGAAATCACTGAAGGGAACTCGAGTTCCCTTCAGTGATTTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012474.3-542s1c1
Sequence:CCGGGAGGAGACAGTTACTGTCTATCTCGAGATAGACAGTAACTGTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012474.3-889s1c1
Sequence:CCGGGCAGACCAATGGCTGTCTCAACTCGAGTTGAGACAGCCATTGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012474.3-365s1c1
Sequence:CCGGGATAGCTTCTACCGTGTCCTTCTCGAGAAGGACACGGTAGAAGCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012474.3-666s21c1
Sequence:GTACCGGGGCTCTCACGCAGAGTATTAACTCGAGTTAATACTCTGCGTGAGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012474.3-1041s21c1
Sequence:GTACCGGATACTGTTTCCTATGACATTACTCGAGTAATGTCATAGGAAACAGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012474
UCK2 MISSION shRNA Lentiviral Transduction Particles
uridine-cytidine kinase 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012474.3-566s1c1
Sequence:CCGGGCAGACGTGGTGCTCTTTGAACTCGAGTTCAAAGAGCACCACGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196976    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012474.3-514s1c1
Sequence:CCGGGTATGACTTTGTCTCCCATTCCTCGAGGAATGGGAGACAAAGTCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194787    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012474.3-1032s1c1
Sequence:CCGGCATCTGTACATACTGTTTCCTCTCGAGAGGAAACAGTATGTACAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195034    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012474.3-444s1c1
Sequence:CCGGCCTTTGACAATGAACTCATTCCTCGAGGAATGAGTTCATTGTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012474.3-705s1c1
Sequence:CCGGGCAGGGATCTTGAGCAGATTTCTCGAGAAATCTGCTCAAGATCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012474.3-475s1c1
Sequence:CCGGCAAAGAAATCACTGAAGGGAACTCGAGTTCCCTTCAGTGATTTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012474.3-542s1c1
Sequence:CCGGGAGGAGACAGTTACTGTCTATCTCGAGATAGACAGTAACTGTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012474.3-889s1c1
Sequence:CCGGGCAGACCAATGGCTGTCTCAACTCGAGTTGAGACAGCCATTGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012474.3-365s1c1
Sequence:CCGGGATAGCTTCTACCGTGTCCTTCTCGAGAAGGACACGGTAGAAGCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012474.3-666s21c1
Sequence:GTACCGGGGCTCTCACGCAGAGTATTAACTCGAGTTAATACTCTGCGTGAGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012474.3-1041s21c1
Sequence:GTACCGGATACTGTTTCCTATGACATTACTCGAGTAATGTCATAGGAAACAGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030724
VALIDATED
UCK2 MISSION shRNA Bacterial Glycerol Stock
uridine-cytidine kinase 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030724.1-526s1c1
Sequence:CCGGGACAACGAACTCATCTTCAAACTCGAGTTTGAAGATGAGTTCGTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030724.1-399s1c1
Sequence:CCGGTGAGGTGGATTACCACCAGAACTCGAGTTCTGGTGGTAATCCACCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030724.1-846s1c1
Sequence:CCGGCTGCTTGCCAACAAAGAAATACTCGAGTATTTCTTTGTTGGCAAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030724.1-817s1c1
Sequence:CCGGACGTTTGTGAAGCCTGCCTTTCTCGAGAAAGGCAGGCTTCACAAACGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030724.1-368s1c1
Sequence:CCGGGTGCTAAGATCGTCCAGCTTTCTCGAGAAAGCTGGACGATCTTAGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030724.3-812s21c1
Sequence:CCGGACGTTTGTGAAGCCTGCCTTTCTCGAGAAAGGCAGGCTTCACAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030724.3-876s21c1
Sequence:CCGGTTCCTAGAGGTGCCGACAATCCTCGAGGATTGTCGGCACCTCTAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276633    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030724.3-1161s21c1
Sequence:CCGGGGAGATGAAATGCCTTGATTTCTCGAGAAATCAAGGCATTTCATCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030724.3-841s21c1
Sequence:CCGGCTGCTTGCCAACAAAGAAATACTCGAGTATTTCTTTGTTGGCAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030724.3-521s21c1
Sequence:CCGGGACAACGAACTCATCTTCAAACTCGAGTTTGAAGATGAGTTCGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030724
VALIDATED
UCK2 MISSION shRNA shRNA Plasmid DNA
uridine-cytidine kinase 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030724.1-526s1c1
Sequence:CCGGGACAACGAACTCATCTTCAAACTCGAGTTTGAAGATGAGTTCGTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030724.1-399s1c1
Sequence:CCGGTGAGGTGGATTACCACCAGAACTCGAGTTCTGGTGGTAATCCACCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030724.1-846s1c1
Sequence:CCGGCTGCTTGCCAACAAAGAAATACTCGAGTATTTCTTTGTTGGCAAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030724.1-817s1c1
Sequence:CCGGACGTTTGTGAAGCCTGCCTTTCTCGAGAAAGGCAGGCTTCACAAACGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030724.1-368s1c1
Sequence:CCGGGTGCTAAGATCGTCCAGCTTTCTCGAGAAAGCTGGACGATCTTAGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030724.3-812s21c1
Sequence:CCGGACGTTTGTGAAGCCTGCCTTTCTCGAGAAAGGCAGGCTTCACAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030724.3-876s21c1
Sequence:CCGGTTCCTAGAGGTGCCGACAATCCTCGAGGATTGTCGGCACCTCTAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276633    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030724.3-1161s21c1
Sequence:CCGGGGAGATGAAATGCCTTGATTTCTCGAGAAATCAAGGCATTTCATCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030724.3-841s21c1
Sequence:CCGGCTGCTTGCCAACAAAGAAATACTCGAGTATTTCTTTGTTGGCAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030724.3-521s21c1
Sequence:CCGGGACAACGAACTCATCTTCAAACTCGAGTTTGAAGATGAGTTCGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030724
VALIDATED
UCK2 MISSION shRNA Lentiviral Transduction Particles
uridine-cytidine kinase 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030724.1-526s1c1
Sequence:CCGGGACAACGAACTCATCTTCAAACTCGAGTTTGAAGATGAGTTCGTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030724.1-399s1c1
Sequence:CCGGTGAGGTGGATTACCACCAGAACTCGAGTTCTGGTGGTAATCCACCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030724.1-846s1c1
Sequence:CCGGCTGCTTGCCAACAAAGAAATACTCGAGTATTTCTTTGTTGGCAAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030724.1-817s1c1
Sequence:CCGGACGTTTGTGAAGCCTGCCTTTCTCGAGAAAGGCAGGCTTCACAAACGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030724.1-368s1c1
Sequence:CCGGGTGCTAAGATCGTCCAGCTTTCTCGAGAAAGCTGGACGATCTTAGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030724.3-812s21c1
Sequence:CCGGACGTTTGTGAAGCCTGCCTTTCTCGAGAAAGGCAGGCTTCACAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030724.3-876s21c1
Sequence:CCGGTTCCTAGAGGTGCCGACAATCCTCGAGGATTGTCGGCACCTCTAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276633    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030724.3-1161s21c1
Sequence:CCGGGGAGATGAAATGCCTTGATTTCTCGAGAAATCAAGGCATTTCATCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030724.3-841s21c1
Sequence:CCGGCTGCTTGCCAACAAAGAAATACTCGAGTATTTCTTTGTTGGCAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030724.3-521s21c1
Sequence:CCGGGACAACGAACTCATCTTCAAACTCGAGTTTGAAGATGAGTTCGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks