EMAIL THIS PAGE TO A FRIEND

UCKL1

uridine-cytidine kinase 1-like 1

Synonyms: UCK1-LIKE UCK1L URKL1
UniProtKB ID: Q9NWZ5, B7Z8N2, Q5JWV0, Q70AQ5, Q8N524, Q9H3Z2
Gene ID:
Mouse(68556) uridine-cytidine kinase 1-like 1
Rat(499956) uridine-cytidine kinase 1-like 1
chicken(771616) uridine-cytidine kinase 1-like 1
domestic cat(101095000) uridine-cytidine kinase 1-like 1
dog(612562) uridine-cytidine kinase 1-like 1
cow(534046) uridine-cytidine kinase 1-like 1
sheep(101116335) uridine-cytidine kinase 1-like 1
naked mole-rat(101701682) uridine-cytidine kinase 1-like 1
domestic guinea pig(100728011) uridine-cytidine kinase 1-like 1
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017859 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017859 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017859 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026765 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026765 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026765 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017859 Rosetta Predictions human pricing
NM_001109212 Rosetta Predictions rat pricing
NM_026765 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017859 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175486 predicted 1608
2 SASI_Hs01_00175487 predicted 1217
3 SASI_Hs01_00175488 predicted 477
4 SASI_Hs01_00175489 predicted 898
5 SASI_Hs01_00175490 predicted 790
6 SASI_Hs01_00175491 predicted 1392
7 SASI_Hs01_00175492 predicted 1529
8 SASI_Hs01_00175493 predicted 887
9 SASI_Hs01_00175494 predicted 1373
10 SASI_Hs01_00175495 predicted 1103
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109212 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246190 predicted 635
2 SASI_Rn02_00246191 predicted 1424
3 SASI_Rn02_00246192 predicted 659
4 SASI_Rn02_00246193 predicted 1097
5 SASI_Rn02_00246194 predicted 1066
6 SASI_Rn02_00246195 predicted 1598
7 SASI_Rn02_00246196 predicted 386
8 SASI_Rn02_00246197 predicted 791
9 SASI_Rn02_00246198 predicted 386
10 SASI_Rn02_00246199 predicted 1232
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026765 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139889 predicted 619
2 SASI_Mm01_00139890 predicted 439
3 SASI_Mm01_00139891 predicted 1390
4 SASI_Mm01_00139892 predicted 1569
5 SASI_Mm01_00139893 predicted 1180
6 SASI_Mm01_00139894 predicted 1031
7 SASI_Mm01_00139896 predicted 443
8 SASI_Mm01_00139897 predicted 304
9 SASI_Mm01_00139898 predicted 810
10 SASI_Mm02_00330829 predicted 1070
11 SASI_Mm01_00139895 predicted 1480
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017859
VALIDATED
UCKL1 MISSION shRNA Bacterial Glycerol Stock
uridine-cytidine kinase 1-like 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017859.2-1614s21c1
Sequence:GTACCGGACTTTGGCGACCGCTACTTTGCTCGAGCAAAGTAGCGGTCGCCAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_017859.1-1088s1c1
Sequence:CCGGCGAGTTCATCTTCTACTCCAACTCGAGTTGGAGTAGAAGATGAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017859.1-533s1c1
Sequence:CCGGCCTCATCATTTCCACCCTCAACTCGAGTTGAGGGTGGAAATGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017859.1-485s1c1
Sequence:CCGGCGCACACAACAACTTCAACTTCTCGAGAAGTTGAAGTTGTTGTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017859.1-1563s1c1
Sequence:CCGGGCGGTGGACAAGCGGGTCAATCTCGAGATTGACCCGCTTGTCCACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_017859.1-806s1c1
Sequence:CCGGGCAGTACAACAAGTTTGTCAACTCGAGTTGACAAACTTGTTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_017859.2-1526s1c1
Sequence:CCGGGCCTATGCATTTCCGCGAGTGCTCGAGCACTCGCGGAAATGCATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_017859.2-1622s1c1
Sequence:CCGGGACCGCTACTTTGGGACAGACCTCGAGGTCTGTCCCAAAGTAGCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_017859.2-1364s1c1
Sequence:CCGGCCCAAGGACATCAGCGATGACCTCGAGGTCATCGCTGATGTCCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_017859.2-583s1c1
Sequence:CCGGGCCCATTTATGACTTCACCACCTCGAGGTGGTGAAGTCATAAATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017859
VALIDATED
UCKL1 MISSION shRNA shRNA Plasmid DNA
uridine-cytidine kinase 1-like 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017859.2-1614s21c1
Sequence:GTACCGGACTTTGGCGACCGCTACTTTGCTCGAGCAAAGTAGCGGTCGCCAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_017859.1-1088s1c1
Sequence:CCGGCGAGTTCATCTTCTACTCCAACTCGAGTTGGAGTAGAAGATGAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017859.1-533s1c1
Sequence:CCGGCCTCATCATTTCCACCCTCAACTCGAGTTGAGGGTGGAAATGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017859.1-485s1c1
Sequence:CCGGCGCACACAACAACTTCAACTTCTCGAGAAGTTGAAGTTGTTGTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017859.1-1563s1c1
Sequence:CCGGGCGGTGGACAAGCGGGTCAATCTCGAGATTGACCCGCTTGTCCACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_017859.1-806s1c1
Sequence:CCGGGCAGTACAACAAGTTTGTCAACTCGAGTTGACAAACTTGTTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_017859.2-1526s1c1
Sequence:CCGGGCCTATGCATTTCCGCGAGTGCTCGAGCACTCGCGGAAATGCATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_017859.2-1622s1c1
Sequence:CCGGGACCGCTACTTTGGGACAGACCTCGAGGTCTGTCCCAAAGTAGCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_017859.2-1364s1c1
Sequence:CCGGCCCAAGGACATCAGCGATGACCTCGAGGTCATCGCTGATGTCCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_017859.2-583s1c1
Sequence:CCGGGCCCATTTATGACTTCACCACCTCGAGGTGGTGAAGTCATAAATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017859
VALIDATED
UCKL1 MISSION shRNA Lentiviral Transduction Particles
uridine-cytidine kinase 1-like 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017859.2-1614s21c1
Sequence:GTACCGGACTTTGGCGACCGCTACTTTGCTCGAGCAAAGTAGCGGTCGCCAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_017859.1-1088s1c1
Sequence:CCGGCGAGTTCATCTTCTACTCCAACTCGAGTTGGAGTAGAAGATGAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017859.1-533s1c1
Sequence:CCGGCCTCATCATTTCCACCCTCAACTCGAGTTGAGGGTGGAAATGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017859.1-485s1c1
Sequence:CCGGCGCACACAACAACTTCAACTTCTCGAGAAGTTGAAGTTGTTGTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017859.1-1563s1c1
Sequence:CCGGGCGGTGGACAAGCGGGTCAATCTCGAGATTGACCCGCTTGTCCACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_017859.1-806s1c1
Sequence:CCGGGCAGTACAACAAGTTTGTCAACTCGAGTTGACAAACTTGTTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_017859.2-1526s1c1
Sequence:CCGGGCCTATGCATTTCCGCGAGTGCTCGAGCACTCGCGGAAATGCATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_017859.2-1622s1c1
Sequence:CCGGGACCGCTACTTTGGGACAGACCTCGAGGTCTGTCCCAAAGTAGCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_017859.2-1364s1c1
Sequence:CCGGCCCAAGGACATCAGCGATGACCTCGAGGTCATCGCTGATGTCCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_017859.2-583s1c1
Sequence:CCGGGCCCATTTATGACTTCACCACCTCGAGGTGGTGAAGTCATAAATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026765
VALIDATED
UCKL1 MISSION shRNA Bacterial Glycerol Stock
uridine-cytidine kinase 1-like 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000322258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026765.3-447s21c1
Sequence:CCGGGCCTGTAACAATTTCAACTTTCTCGAGAAAGTTGAAATTGTTACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026765.3-744s21c1
Sequence:CCGGCGGGACATTGAGGGTGTCATTCTCGAGAATGACACCCTCAATGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026765.3-768s21c1
Sequence:CCGGCAGTACAACAAGTTTGTCAAACTCGAGTTTGACAAACTTGTTGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026765.3-661s21c1
Sequence:CCGGTCCTGGACATGAAGATCTTTGCTCGAGCAAAGATCTTCATGTCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026765.3-297s21c1
Sequence:CCGGGCCTTTGCTATTGGCTTAGGACTCGAGTCCTAAGCCAATAGCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026765.2-447s1c1
Sequence:CCGGGCCTGTAACAATTTCAACTTTCTCGAGAAAGTTGAAATTGTTACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026765.2-744s1c1
Sequence:CCGGCGGGACATTGAGGGTGTCATTCTCGAGAATGACACCCTCAATGTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026765.2-768s1c1
Sequence:CCGGCAGTACAACAAGTTTGTCAAACTCGAGTTTGACAAACTTGTTGTACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026765.2-297s1c1
Sequence:CCGGGCCTTTGCTATTGGCTTAGGACTCGAGTCCTAAGCCAATAGCAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026765.2-1584s1c1
Sequence:CCGGGATCGCTACTTTGGGACAGATCTCGAGATCTGTCCCAAAGTAGCGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026765
VALIDATED
UCKL1 MISSION shRNA shRNA Plasmid DNA
uridine-cytidine kinase 1-like 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000322258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026765.3-447s21c1
Sequence:CCGGGCCTGTAACAATTTCAACTTTCTCGAGAAAGTTGAAATTGTTACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026765.3-744s21c1
Sequence:CCGGCGGGACATTGAGGGTGTCATTCTCGAGAATGACACCCTCAATGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026765.3-768s21c1
Sequence:CCGGCAGTACAACAAGTTTGTCAAACTCGAGTTTGACAAACTTGTTGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026765.3-661s21c1
Sequence:CCGGTCCTGGACATGAAGATCTTTGCTCGAGCAAAGATCTTCATGTCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026765.3-297s21c1
Sequence:CCGGGCCTTTGCTATTGGCTTAGGACTCGAGTCCTAAGCCAATAGCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026765.2-447s1c1
Sequence:CCGGGCCTGTAACAATTTCAACTTTCTCGAGAAAGTTGAAATTGTTACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026765.2-744s1c1
Sequence:CCGGCGGGACATTGAGGGTGTCATTCTCGAGAATGACACCCTCAATGTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026765.2-768s1c1
Sequence:CCGGCAGTACAACAAGTTTGTCAAACTCGAGTTTGACAAACTTGTTGTACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026765.2-297s1c1
Sequence:CCGGGCCTTTGCTATTGGCTTAGGACTCGAGTCCTAAGCCAATAGCAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026765.2-1584s1c1
Sequence:CCGGGATCGCTACTTTGGGACAGATCTCGAGATCTGTCCCAAAGTAGCGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026765
VALIDATED
UCKL1 MISSION shRNA Lentiviral Transduction Particles
uridine-cytidine kinase 1-like 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000322258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026765.3-447s21c1
Sequence:CCGGGCCTGTAACAATTTCAACTTTCTCGAGAAAGTTGAAATTGTTACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026765.3-744s21c1
Sequence:CCGGCGGGACATTGAGGGTGTCATTCTCGAGAATGACACCCTCAATGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026765.3-768s21c1
Sequence:CCGGCAGTACAACAAGTTTGTCAAACTCGAGTTTGACAAACTTGTTGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026765.3-661s21c1
Sequence:CCGGTCCTGGACATGAAGATCTTTGCTCGAGCAAAGATCTTCATGTCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026765.3-297s21c1
Sequence:CCGGGCCTTTGCTATTGGCTTAGGACTCGAGTCCTAAGCCAATAGCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026765.2-447s1c1
Sequence:CCGGGCCTGTAACAATTTCAACTTTCTCGAGAAAGTTGAAATTGTTACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026765.2-744s1c1
Sequence:CCGGCGGGACATTGAGGGTGTCATTCTCGAGAATGACACCCTCAATGTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026765.2-768s1c1
Sequence:CCGGCAGTACAACAAGTTTGTCAAACTCGAGTTTGACAAACTTGTTGTACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026765.2-297s1c1
Sequence:CCGGGCCTTTGCTATTGGCTTAGGACTCGAGTCCTAAGCCAATAGCAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026765.2-1584s1c1
Sequence:CCGGGATCGCTACTTTGGGACAGATCTCGAGATCTGTCCCAAAGTAGCGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks