EMAIL THIS PAGE TO A FRIEND

UCMA

upper zone of growth plate and cartilage matrix associated

Synonyms: C10orf49 GRP
UniProtKB ID: Q8WVF2
Gene ID:
Mouse(68527) upper zone of growth plate and cartilage matrix associated
Rat(291312) upper zone of growth plate and cartilage matrix associated
Horse(100069244) upper zone of growth plate and cartilage matrix associated
dog(478002) upper zone of growth plate and cartilage matrix associated
domestic cat(101097989) upper zone of growth plate and cartilage matrix associated
domestic guinea pig(100722253) upper zone of growth plate and cartilage matrix associated
naked mole-rat(101726595) upper zone of growth plate and cartilage matrix associated
cow(615924) upper zone of growth plate and cartilage matrix associated
66 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026754 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026754 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026754 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145314 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145314 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145314 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145314 Rosetta Predictions human pricing
NM_001106121 Rosetta Predictions rat pricing
XM_214510 Rosetta Predictions rat pricing
NM_001113558 Rosetta Predictions mouse pricing
NM_026754 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145314 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233154 predicted 293
2 SASI_Hs01_00233156 predicted 216
3 SASI_Hs01_00233157 predicted 478
4 SASI_Hs01_00233158 predicted 537
5 SASI_Hs01_00233159 predicted 514
6 SASI_Hs01_00233160 predicted 508
7 SASI_Hs02_00365217 predicted 222
8 SASI_Hs01_00233161 predicted 501
9 SASI_Hs02_00365218 predicted 475
10 SASI_Hs01_00233163 predicted 226
11 SASI_Hs01_00233155 predicted 475
12 SASI_Hs01_00233162 predicted 332
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106121 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215828 predicted 198
2 SASI_Rn02_00215829 predicted 483
3 SASI_Rn02_00215830 predicted 421
4 SASI_Rn02_00215831 predicted 362
5 SASI_Rn02_00215832 predicted 317
6 SASI_Rn02_00215833 predicted 204
7 SASI_Rn02_00215834 predicted 199
8 SASI_Rn02_00215835 predicted 317
9 SASI_Rn02_00215836 predicted 232
10 SASI_Rn02_00215837 predicted 321
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214510 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00186178 predicted 744
2 SASI_Rn01_00186179 predicted 892
3 SASI_Rn01_00186180 predicted 802
4 SASI_Rn01_00186181 predicted 655
5 SASI_Rn01_00186182 predicted 811
6 SASI_Rn01_00186183 predicted 746
7 SASI_Rn01_00186184 predicted 725
8 SASI_Rn01_00186185 predicted 796
9 SASI_Rn01_00186186 predicted 747
10 SASI_Rn01_00186187 predicted 802
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113558 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308179 predicted 476
2 SASI_Mm02_00308180 predicted 478
3 SASI_Mm02_00308181 predicted 323
4 SASI_Mm02_00308182 predicted 284
5 SASI_Mm02_00308183 predicted 329
6 SASI_Mm02_00308184 predicted 277
7 SASI_Mm02_00308185 predicted 330
8 SASI_Mm02_00308186 predicted 357
9 SASI_Mm02_00308187 predicted 395
10 SASI_Mm02_00308188 predicted 314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026754 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128338 predicted 230
2 SASI_Mm01_00128339 predicted 351
3 SASI_Mm01_00128340 predicted 358
4 SASI_Mm01_00128341 predicted 229
5 SASI_Mm01_00128342 predicted 351
6 SASI_Mm01_00128343 predicted 208
7 SASI_Mm01_00128344 predicted 199
8 SASI_Mm01_00128345 predicted 240
9 SASI_Mm01_00128346 predicted 266
10 SASI_Mm01_00128347 predicted 356
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026754
UCMA MISSION shRNA Bacterial Glycerol Stock
upper zone of growth plate and cartilage matrix associated
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026754.1-383s1c1
Sequence:CCGGGCCTTTATCCTTCCTACCTCTCTCGAGAGAGGTAGGAAGGATAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179313    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026754.1-282s1c1
Sequence:CCGGGCAAAGGAACGAGTTTGAGAACTCGAGTTCTCAAACTCGTTCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026754.2-156s1c1
Sequence:CCGGGAATCTGATGCCTCCAATTTCCTCGAGGAAATTGGAGGCATCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026754.2-155s21c1
Sequence:CCGGAGAATCTGATGCCTCCAATTTCTCGAGAAATTGGAGGCATCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026754.2-254s21c1
Sequence:CCGGTGAGCTGCGGAGGGAGTATTACTCGAGTAATACTCCCTCCGCAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026754.2-277s21c1
Sequence:CCGGAGGAGCAAAGGAACGAGTTTGCTCGAGCAAACTCGTTCCTTTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026754.2-203s21c1
Sequence:CCGGTAAGTCCCGAGATGAAGTTAACTCGAGTTAACTTCATCTCGGGACTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026754.2-570s21c1
Sequence:CCGGTTGCTTCTTTATGGATGTTTGCTCGAGCAAACATCCATAAAGAAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026754
UCMA MISSION shRNA shRNA Plasmid DNA
upper zone of growth plate and cartilage matrix associated
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026754.1-383s1c1
Sequence:CCGGGCCTTTATCCTTCCTACCTCTCTCGAGAGAGGTAGGAAGGATAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179313    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026754.1-282s1c1
Sequence:CCGGGCAAAGGAACGAGTTTGAGAACTCGAGTTCTCAAACTCGTTCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026754.2-156s1c1
Sequence:CCGGGAATCTGATGCCTCCAATTTCCTCGAGGAAATTGGAGGCATCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026754.2-155s21c1
Sequence:CCGGAGAATCTGATGCCTCCAATTTCTCGAGAAATTGGAGGCATCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026754.2-254s21c1
Sequence:CCGGTGAGCTGCGGAGGGAGTATTACTCGAGTAATACTCCCTCCGCAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026754.2-277s21c1
Sequence:CCGGAGGAGCAAAGGAACGAGTTTGCTCGAGCAAACTCGTTCCTTTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026754.2-203s21c1
Sequence:CCGGTAAGTCCCGAGATGAAGTTAACTCGAGTTAACTTCATCTCGGGACTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026754.2-570s21c1
Sequence:CCGGTTGCTTCTTTATGGATGTTTGCTCGAGCAAACATCCATAAAGAAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026754
UCMA MISSION shRNA Lentiviral Transduction Particles
upper zone of growth plate and cartilage matrix associated
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026754.1-383s1c1
Sequence:CCGGGCCTTTATCCTTCCTACCTCTCTCGAGAGAGGTAGGAAGGATAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179313    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026754.1-282s1c1
Sequence:CCGGGCAAAGGAACGAGTTTGAGAACTCGAGTTCTCAAACTCGTTCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026754.2-156s1c1
Sequence:CCGGGAATCTGATGCCTCCAATTTCCTCGAGGAAATTGGAGGCATCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026754.2-155s21c1
Sequence:CCGGAGAATCTGATGCCTCCAATTTCTCGAGAAATTGGAGGCATCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026754.2-254s21c1
Sequence:CCGGTGAGCTGCGGAGGGAGTATTACTCGAGTAATACTCCCTCCGCAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026754.2-277s21c1
Sequence:CCGGAGGAGCAAAGGAACGAGTTTGCTCGAGCAAACTCGTTCCTTTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026754.2-203s21c1
Sequence:CCGGTAAGTCCCGAGATGAAGTTAACTCGAGTTAACTTCATCTCGGGACTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026754.2-570s21c1
Sequence:CCGGTTGCTTCTTTATGGATGTTTGCTCGAGCAAACATCCATAAAGAAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145314
UCMA MISSION shRNA Bacterial Glycerol Stock
upper zone of growth plate and cartilage matrix associated
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172305    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145314.1-550s1c1
Sequence:CCGGCCAGCAATCTTTCCCATGCAACTCGAGTTGCATGGGAAAGATTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172493    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145314.1-671s1c1
Sequence:CCGGCACCTCTTTGCAGACCATCATCTCGAGATGATGGTCTGCAAAGAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172974    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145314.1-328s1c1
Sequence:CCGGGCGGAGAGAATATTACGAGGACTCGAGTCCTCGTAATATTCTCTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145314.1-333s1c1
Sequence:CCGGGAGAATATTACGAGGAACAAACTCGAGTTTGTTCCTCGTAATATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145314.1-350s1c1
Sequence:CCGGCAAAGGAATGAATTTGAGAACCTCGAGGTTCTCAAATTCATTCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145314.1-136s21c1
Sequence:CCGGGAGAGAGGGAACCAGTGTATCCTCGAGGATACACTGGTTCCCTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145314.1-273s21c1
Sequence:CCGGAGTCCCGAGATGAGGTCAATGCTCGAGCATTGACCTCATCTCGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145314.1-224s21c1
Sequence:CCGGGAATCAGATGCCTCGAATTTCCTCGAGGAAATTCGAGGCATCTGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145314
UCMA MISSION shRNA shRNA Plasmid DNA
upper zone of growth plate and cartilage matrix associated
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172305    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145314.1-550s1c1
Sequence:CCGGCCAGCAATCTTTCCCATGCAACTCGAGTTGCATGGGAAAGATTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172493    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145314.1-671s1c1
Sequence:CCGGCACCTCTTTGCAGACCATCATCTCGAGATGATGGTCTGCAAAGAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172974    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145314.1-328s1c1
Sequence:CCGGGCGGAGAGAATATTACGAGGACTCGAGTCCTCGTAATATTCTCTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145314.1-333s1c1
Sequence:CCGGGAGAATATTACGAGGAACAAACTCGAGTTTGTTCCTCGTAATATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145314.1-350s1c1
Sequence:CCGGCAAAGGAATGAATTTGAGAACCTCGAGGTTCTCAAATTCATTCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145314.1-136s21c1
Sequence:CCGGGAGAGAGGGAACCAGTGTATCCTCGAGGATACACTGGTTCCCTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145314.1-273s21c1
Sequence:CCGGAGTCCCGAGATGAGGTCAATGCTCGAGCATTGACCTCATCTCGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145314.1-224s21c1
Sequence:CCGGGAATCAGATGCCTCGAATTTCCTCGAGGAAATTCGAGGCATCTGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145314
UCMA MISSION shRNA Lentiviral Transduction Particles
upper zone of growth plate and cartilage matrix associated
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172305    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145314.1-550s1c1
Sequence:CCGGCCAGCAATCTTTCCCATGCAACTCGAGTTGCATGGGAAAGATTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172493    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145314.1-671s1c1
Sequence:CCGGCACCTCTTTGCAGACCATCATCTCGAGATGATGGTCTGCAAAGAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172974    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145314.1-328s1c1
Sequence:CCGGGCGGAGAGAATATTACGAGGACTCGAGTCCTCGTAATATTCTCTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145314.1-333s1c1
Sequence:CCGGGAGAATATTACGAGGAACAAACTCGAGTTTGTTCCTCGTAATATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145314.1-350s1c1
Sequence:CCGGCAAAGGAATGAATTTGAGAACCTCGAGGTTCTCAAATTCATTCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145314.1-136s21c1
Sequence:CCGGGAGAGAGGGAACCAGTGTATCCTCGAGGATACACTGGTTCCCTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145314.1-273s21c1
Sequence:CCGGAGTCCCGAGATGAGGTCAATGCTCGAGCATTGACCTCATCTCGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145314.1-224s21c1
Sequence:CCGGGAATCAGATGCCTCGAATTTCCTCGAGGAAATTCGAGGCATCTGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks