EMAIL THIS PAGE TO A FRIEND

UCN2

urocortin 2

Synonyms: SRP UCN-II UCNI UR URP
UniProtKB ID: Q96RP3, Q9BUG0
Gene ID:
Human(90226) Summary: This gene is a member of the sauvagine/corticotropin-releasing factor/urotensin I family. It is structurally related to the corticotropin-releasing factor (CRF) gene and the encoded product is an endogenous ligand for CRF type 2 receptors. In the brain it may be responsible for the effects of stress on appetite. In spite of the gene family name similarity, the product of this gene has no sequence similarity to urotensin II. [provided by RefSeq, Jul 2008]
Mouse(171530) urocortin 2
Rat(170896) urocortin 2
cow(751828) urocortin 2
sheep(101110368) urocortin 2
dog(100683848) urocortin 2
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA066841 Anti-UCN2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033199 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033199 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033199 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033199 Rosetta Predictions human pricing
NM_133385 Rosetta Predictions rat pricing
XM_910603 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033199 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217312 predicted 565
2 SASI_Hs01_00217313 predicted 874
3 SASI_Hs01_00217315 predicted 720
4 SASI_Hs01_00217316 predicted 531
5 SASI_Hs01_00217317 predicted 316
6 SASI_Hs01_00217318 predicted 629
7 SASI_Hs01_00217319 predicted 698
8 SASI_Hs01_00217320 predicted 731
9 SASI_Hs02_00360991 predicted 840
10 SASI_Hs01_00217321 predicted 489
11 SASI_Hs01_00217314 predicted 609
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133385 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058894 predicted 184
2 SASI_Rn01_00058895 predicted 307
3 SASI_Rn01_00058896 predicted 152
4 SASI_Rn01_00058897 predicted 262
5 SASI_Rn01_00058899 predicted 275
6 SASI_Rn01_00058900 predicted 287
7 SASI_Rn01_00058901 predicted 285
8 SASI_Rn01_00058902 predicted 281
9 SASI_Rn01_00058903 predicted 278
10 SASI_Rn02_00267645 predicted 255
11 SASI_Rn01_00058898 predicted 158
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_910603 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00435716 predicted 290
2 SASI_Mm02_00435717 predicted 190
3 SASI_Mm02_00435718 predicted 230
4 SASI_Mm02_00435719 predicted 269
5 SASI_Mm02_00435720 predicted 42
6 SASI_Mm02_00435721 predicted 285
7 SASI_Mm02_00435722 predicted 101
8 SASI_Mm02_00435723 predicted 31
9 SASI_Mm02_00435724 predicted 263
10 SASI_Mm02_00435725 predicted 29
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033199
UCN2 MISSION shRNA Bacterial Glycerol Stock
urocortin 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033199.3-324s1c1
Sequence:CCGGCTTGCAGATCTTACTGGAGCACTCGAGTGCTCCAGTAAGATCTGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157999    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033199.3-571s1c1
Sequence:CCGGCCACTGTCATGCAGGTCATATCTCGAGATATGACCTGCATGACAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157895    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033199.3-633s1c1
Sequence:CCGGCCTGGACATTGGACATTGCTACTCGAGTAGCAATGTCCAATGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033199.3-321s1c1
Sequence:CCGGCCTCTTGCAGATCTTACTGGACTCGAGTCCAGTAAGATCTGCAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153965    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033199.3-1355s1c1
Sequence:CCGGCCTCGGTTTCCTTATCTGTAACTCGAGTTACAGATAAGGAAACCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151416    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033199.3-814s1c1
Sequence:CCGGGCAGTCATCATCATGTTACTTCTCGAGAAGTAACATGATGATGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033199.3-290s21c1
Sequence:CCGGGCATTGTCCTATCGCTGGATGCTCGAGCATCCAGCGATAGGACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373836    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033199.3-890s21c1
Sequence:CCGGCACAGGTCTGTCATCCCATAGCTCGAGCTATGGGATGACAGACCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373920    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033199.3-845s21c1
Sequence:CCGGCAACACGAGAGCTCAACACTGCTCGAGCAGTGTTGAGCTCTCGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033199
UCN2 MISSION shRNA shRNA Plasmid DNA
urocortin 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033199.3-324s1c1
Sequence:CCGGCTTGCAGATCTTACTGGAGCACTCGAGTGCTCCAGTAAGATCTGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157999    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033199.3-571s1c1
Sequence:CCGGCCACTGTCATGCAGGTCATATCTCGAGATATGACCTGCATGACAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157895    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033199.3-633s1c1
Sequence:CCGGCCTGGACATTGGACATTGCTACTCGAGTAGCAATGTCCAATGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033199.3-321s1c1
Sequence:CCGGCCTCTTGCAGATCTTACTGGACTCGAGTCCAGTAAGATCTGCAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153965    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033199.3-1355s1c1
Sequence:CCGGCCTCGGTTTCCTTATCTGTAACTCGAGTTACAGATAAGGAAACCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151416    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033199.3-814s1c1
Sequence:CCGGGCAGTCATCATCATGTTACTTCTCGAGAAGTAACATGATGATGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033199.3-290s21c1
Sequence:CCGGGCATTGTCCTATCGCTGGATGCTCGAGCATCCAGCGATAGGACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373836    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033199.3-890s21c1
Sequence:CCGGCACAGGTCTGTCATCCCATAGCTCGAGCTATGGGATGACAGACCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373920    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033199.3-845s21c1
Sequence:CCGGCAACACGAGAGCTCAACACTGCTCGAGCAGTGTTGAGCTCTCGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033199
UCN2 MISSION shRNA Lentiviral Transduction Particles
urocortin 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033199.3-324s1c1
Sequence:CCGGCTTGCAGATCTTACTGGAGCACTCGAGTGCTCCAGTAAGATCTGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157999    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033199.3-571s1c1
Sequence:CCGGCCACTGTCATGCAGGTCATATCTCGAGATATGACCTGCATGACAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157895    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033199.3-633s1c1
Sequence:CCGGCCTGGACATTGGACATTGCTACTCGAGTAGCAATGTCCAATGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033199.3-321s1c1
Sequence:CCGGCCTCTTGCAGATCTTACTGGACTCGAGTCCAGTAAGATCTGCAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153965    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033199.3-1355s1c1
Sequence:CCGGCCTCGGTTTCCTTATCTGTAACTCGAGTTACAGATAAGGAAACCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151416    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033199.3-814s1c1
Sequence:CCGGGCAGTCATCATCATGTTACTTCTCGAGAAGTAACATGATGATGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033199.3-290s21c1
Sequence:CCGGGCATTGTCCTATCGCTGGATGCTCGAGCATCCAGCGATAGGACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373836    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033199.3-890s21c1
Sequence:CCGGCACAGGTCTGTCATCCCATAGCTCGAGCTATGGGATGACAGACCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373920    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033199.3-845s21c1
Sequence:CCGGCAACACGAGAGCTCAACACTGCTCGAGCAGTGTTGAGCTCTCGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks