EMAIL THIS PAGE TO A FRIEND

UCN3

urocortin 3

Synonyms: SCP SPC UCNIII
UniProtKB ID: Q969E3, Q496H2, Q5SR91
Gene ID:
Human(114131) Summary: This gene is a member of the sauvagine/corticotropin-releasing factor/urotensin I family. It is structurally related to the corticotropin-releasing factor (CRF) gene and the encoded product is an endogenous ligand for CRF type 2 receptors. In the brain it may be responsible for the effects of stress on appetite. In spite of the gene family name similarity, the product of this gene has no sequence similarity to urotensin II. [provided by RefSeq, Jul 2008]
Mouse(83428) urocortin 3
Rat(498791) urocortin 3
chicken(769274) urocortin 3 (stresscopin)
dog(608752) urocortin 3 (stresscopin)
cow(751573) urocortin 3 (stresscopin)
sheep(101106349) urocortin 3
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031250 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031250 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031250 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_053049 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_053049 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_053049 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_053049 Rosetta Predictions human pricing
NM_001080208 Rosetta Predictions rat pricing
NM_031250 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053049 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200997 predicted 378
2 SASI_Hs01_00200998 predicted 364
3 SASI_Hs01_00201001 predicted 420
4 SASI_Hs01_00201002 predicted 484
5 SASI_Hs01_00201004 predicted 483
6 SASI_Hs01_00201005 predicted 354
7 SASI_Hs01_00201006 predicted 369
8 SASI_Hs01_00200999 predicted 408
9 SASI_Hs01_00201003 predicted 336
10 SASI_Hs02_00361889 predicted 286
11 SASI_Hs01_00201000 predicted 341
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080208 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208469 predicted 213
2 SASI_Rn02_00208470 predicted 287
3 SASI_Rn02_00208471 predicted 279
4 SASI_Rn02_00208472 predicted 304
5 SASI_Rn02_00208473 predicted 218
6 SASI_Rn02_00208474 predicted 223
7 SASI_Rn02_00208475 predicted 262
8 SASI_Rn02_00208476 predicted 219
9 SASI_Rn02_00208477 predicted 298
10 SASI_Rn02_00208478 predicted 210
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031250 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163615 predicted 942
2 SASI_Mm01_00163616 predicted 569
3 SASI_Mm01_00163617 predicted 1158
4 SASI_Mm01_00163618 predicted 1195
5 SASI_Mm01_00163619 predicted 899
6 SASI_Mm01_00163620 predicted 733
7 SASI_Mm01_00163621 predicted 877
8 SASI_Mm01_00163622 predicted 1163
9 SASI_Mm01_00163623 predicted 522
10 SASI_Mm01_00163624 predicted 839
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031250
UCN3 MISSION shRNA Bacterial Glycerol Stock
urocortin 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031250.4-629s21c1
Sequence:CCGGAGCCCTATCTGAGGTCAAGAACTCGAGTTCTTGACCTCAGATAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031250.4-894s1c1
Sequence:CCGGCTTGATGTTCCCACTAACATCCTCGAGGATGTTAGTGGGAACATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249387    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031250.4-1215s21c1
Sequence:CCGGATATCCACAATGGAGGTTAACCTCGAGGTTAACCTCCATTGTGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031250.4-976s21c1
Sequence:CCGGCTCAGCTCATGGCACAGATTGCTCGAGCAATCTGTGCCATGAGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031250.4-932s21c1
Sequence:CCGGCATCGACAAGGCCAAGAATTTCTCGAGAAATTCTTGGCCTTGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031250.4-800s21c1
Sequence:CCGGCACCCGGTACAGATACCAATCCTCGAGGATTGGTATCTGTACCGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202258    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031250.2-75s1c1
Sequence:CCGGGTTCTACAACACTGGACCAGTCTCGAGACTGGTCCAGTGTTGTAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031250.2-117s1c1
Sequence:CCGGCCTATCTGAGGTCAAGAAGAACTCGAGTTCTTCTTGACCTCAGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031250
UCN3 MISSION shRNA shRNA Plasmid DNA
urocortin 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031250.4-629s21c1
Sequence:CCGGAGCCCTATCTGAGGTCAAGAACTCGAGTTCTTGACCTCAGATAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031250.4-894s1c1
Sequence:CCGGCTTGATGTTCCCACTAACATCCTCGAGGATGTTAGTGGGAACATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249387    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031250.4-1215s21c1
Sequence:CCGGATATCCACAATGGAGGTTAACCTCGAGGTTAACCTCCATTGTGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031250.4-976s21c1
Sequence:CCGGCTCAGCTCATGGCACAGATTGCTCGAGCAATCTGTGCCATGAGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031250.4-932s21c1
Sequence:CCGGCATCGACAAGGCCAAGAATTTCTCGAGAAATTCTTGGCCTTGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031250.4-800s21c1
Sequence:CCGGCACCCGGTACAGATACCAATCCTCGAGGATTGGTATCTGTACCGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202258    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031250.2-75s1c1
Sequence:CCGGGTTCTACAACACTGGACCAGTCTCGAGACTGGTCCAGTGTTGTAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031250.2-117s1c1
Sequence:CCGGCCTATCTGAGGTCAAGAAGAACTCGAGTTCTTCTTGACCTCAGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031250
UCN3 MISSION shRNA Lentiviral Transduction Particles
urocortin 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031250.4-629s21c1
Sequence:CCGGAGCCCTATCTGAGGTCAAGAACTCGAGTTCTTGACCTCAGATAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031250.4-894s1c1
Sequence:CCGGCTTGATGTTCCCACTAACATCCTCGAGGATGTTAGTGGGAACATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249387    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031250.4-1215s21c1
Sequence:CCGGATATCCACAATGGAGGTTAACCTCGAGGTTAACCTCCATTGTGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031250.4-976s21c1
Sequence:CCGGCTCAGCTCATGGCACAGATTGCTCGAGCAATCTGTGCCATGAGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031250.4-932s21c1
Sequence:CCGGCATCGACAAGGCCAAGAATTTCTCGAGAAATTCTTGGCCTTGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031250.4-800s21c1
Sequence:CCGGCACCCGGTACAGATACCAATCCTCGAGGATTGGTATCTGTACCGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202258    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031250.2-75s1c1
Sequence:CCGGGTTCTACAACACTGGACCAGTCTCGAGACTGGTCCAGTGTTGTAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031250.2-117s1c1
Sequence:CCGGCCTATCTGAGGTCAAGAAGAACTCGAGTTCTTCTTGACCTCAGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053049
UCN3 MISSION shRNA Bacterial Glycerol Stock
urocortin 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053049.2-293s21c1
Sequence:CCGGCCACAAGTTCTACAAAGCCAACTCGAGTTGGCTTTGTAGAACTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053049.2-317s21c1
Sequence:CCGGCATCTTCAGCTGCCTCAACACCTCGAGGTGTTGAGGCAGCTGAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053049.2-304s21c1
Sequence:CCGGACAAAGCCAAGCCCATCTTCACTCGAGTGAAGATGGGCTTGGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053049.2-504s21c1
Sequence:CCGGCGGTACAGATACGTGTCCCAACTCGAGTTGGGACACGTATCTGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053049.2-386s21c1
Sequence:CCGGGAGCAAGAGGAGCTTCCACTACTCGAGTAGTGGAAGCTCCTCTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053049
UCN3 MISSION shRNA shRNA Plasmid DNA
urocortin 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053049.2-293s21c1
Sequence:CCGGCCACAAGTTCTACAAAGCCAACTCGAGTTGGCTTTGTAGAACTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053049.2-317s21c1
Sequence:CCGGCATCTTCAGCTGCCTCAACACCTCGAGGTGTTGAGGCAGCTGAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053049.2-304s21c1
Sequence:CCGGACAAAGCCAAGCCCATCTTCACTCGAGTGAAGATGGGCTTGGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053049.2-504s21c1
Sequence:CCGGCGGTACAGATACGTGTCCCAACTCGAGTTGGGACACGTATCTGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053049.2-386s21c1
Sequence:CCGGGAGCAAGAGGAGCTTCCACTACTCGAGTAGTGGAAGCTCCTCTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053049
UCN3 MISSION shRNA Lentiviral Transduction Particles
urocortin 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053049.2-293s21c1
Sequence:CCGGCCACAAGTTCTACAAAGCCAACTCGAGTTGGCTTTGTAGAACTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053049.2-317s21c1
Sequence:CCGGCATCTTCAGCTGCCTCAACACCTCGAGGTGTTGAGGCAGCTGAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053049.2-304s21c1
Sequence:CCGGACAAAGCCAAGCCCATCTTCACTCGAGTGAAGATGGGCTTGGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053049.2-504s21c1
Sequence:CCGGCGGTACAGATACGTGTCCCAACTCGAGTTGGGACACGTATCTGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053049.2-386s21c1
Sequence:CCGGGAGCAAGAGGAGCTTCCACTACTCGAGTAGTGGAAGCTCCTCTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks