EMAIL THIS PAGE TO A FRIEND

UCN

urocortin

Synonyms: UI UROC
UniProtKB ID: P55089, Q6FG64
Gene ID:
Human(7349) Summary: This gene is a member of the sauvagine/corticotropin-releasing factor/urotensin I family. It is structurally related to the corticotropin-releasing factor (CRF) gene and the encoded product is an endogenous ligand for CRF type 2 receptors. In the brain it may be responsible for the effects of stress on appetite. In spite of the gene family name similarity, the product of this gene has no sequence similarity to urotensin II. [provided by RefSeq, Jul 2008]
Mouse(22226) urocortin
Rat(29151) urocortin
dog(611041) urocortin
cow(518336) urocortin
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003353 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003353 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003353 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021290 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021290 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021290 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003353 Rosetta Predictions human pricing
NM_019150 Rosetta Predictions rat pricing
NM_021290 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003353 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136027 predicted 355
2 SASI_Hs01_00136028 predicted 442
3 SASI_Hs01_00136029 predicted 449
4 SASI_Hs01_00136030 predicted 447
5 SASI_Hs01_00136031 predicted 447
6 SASI_Hs01_00136032 predicted 561
7 SASI_Hs01_00136033 predicted 439
8 SASI_Hs02_00335503 predicted 349
9 SASI_Hs01_00136034 predicted 343
10 SASI_Hs01_00136035 predicted 373
11 SASI_Hs01_00136036 predicted 562
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019150 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047094 predicted 213
2 SASI_Rn01_00047095 predicted 218
3 SASI_Rn01_00047097 predicted 303
4 SASI_Rn01_00047098 predicted 220
5 SASI_Rn01_00047099 predicted 202
6 SASI_Rn01_00047101 predicted 332
7 SASI_Rn01_00047102 predicted 257
8 SASI_Rn01_00047103 predicted 343
9 SASI_Rn02_00261923 predicted 205
10 SASI_Rn02_00261924 predicted 307
11 SASI_Rn01_00047096 predicted 309
12 SASI_Rn01_00047100 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021290 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182480 predicted 267
2 SASI_Mm01_00182481 predicted 261
3 SASI_Mm01_00182482 predicted 238
4 SASI_Mm01_00182483 predicted 266
5 SASI_Mm01_00182484 predicted 275
6 SASI_Mm02_00325821 predicted 404
7 SASI_Mm01_00182486 predicted 297
8 SASI_Mm01_00182487 predicted 392
9 SASI_Mm01_00182488 predicted 393
10 SASI_Mm01_00182489 predicted 305
11 SASI_Mm01_00182485 predicted 344
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003353
UCN MISSION shRNA Bacterial Glycerol Stock
urocortin
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003353.2-364s21c1
Sequence:CCGGACAACCCTTCTCTGTCCATTGCTCGAGCAATGGACAGAGAAGGGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003353.2-217s21c1
Sequence:CCGGAGGACCCGAGTCTGCGCTGGACTCGAGTCCAGCGCAGACTCGGGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003353.2-375s1c1
Sequence:CCGGCTGTCCATTGACCTCACCTTTCTCGAGAAAGGTGAGGTCAATGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003353.2-324s1c1
Sequence:CCGGCGATTGGGACTCGGGACGGCACTCGAGTGCCGTCCCGAGTCCCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003353.2-159s1c1
Sequence:CCGGCTCCTGGTACAGCTGTGCCCTCTCGAGAGGGCACAGCTGTACCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003353.2-461s1c1
Sequence:CCGGCCGCATCATATTCGACTCGGTCTCGAGACCGAGTCGAATATGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003353.2-452s1c1
Sequence:CCGGCGAGCAGAACCGCATCATATTCTCGAGAATATGATGCGGTTCTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003353
UCN MISSION shRNA shRNA Plasmid DNA
urocortin
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003353.2-364s21c1
Sequence:CCGGACAACCCTTCTCTGTCCATTGCTCGAGCAATGGACAGAGAAGGGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003353.2-217s21c1
Sequence:CCGGAGGACCCGAGTCTGCGCTGGACTCGAGTCCAGCGCAGACTCGGGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003353.2-375s1c1
Sequence:CCGGCTGTCCATTGACCTCACCTTTCTCGAGAAAGGTGAGGTCAATGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003353.2-324s1c1
Sequence:CCGGCGATTGGGACTCGGGACGGCACTCGAGTGCCGTCCCGAGTCCCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003353.2-159s1c1
Sequence:CCGGCTCCTGGTACAGCTGTGCCCTCTCGAGAGGGCACAGCTGTACCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003353.2-461s1c1
Sequence:CCGGCCGCATCATATTCGACTCGGTCTCGAGACCGAGTCGAATATGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003353.2-452s1c1
Sequence:CCGGCGAGCAGAACCGCATCATATTCTCGAGAATATGATGCGGTTCTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003353
UCN MISSION shRNA Lentiviral Transduction Particles
urocortin
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003353.2-364s21c1
Sequence:CCGGACAACCCTTCTCTGTCCATTGCTCGAGCAATGGACAGAGAAGGGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003353.2-217s21c1
Sequence:CCGGAGGACCCGAGTCTGCGCTGGACTCGAGTCCAGCGCAGACTCGGGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003353.2-375s1c1
Sequence:CCGGCTGTCCATTGACCTCACCTTTCTCGAGAAAGGTGAGGTCAATGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003353.2-324s1c1
Sequence:CCGGCGATTGGGACTCGGGACGGCACTCGAGTGCCGTCCCGAGTCCCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003353.2-159s1c1
Sequence:CCGGCTCCTGGTACAGCTGTGCCCTCTCGAGAGGGCACAGCTGTACCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003353.2-461s1c1
Sequence:CCGGCCGCATCATATTCGACTCGGTCTCGAGACCGAGTCGAATATGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003353.2-452s1c1
Sequence:CCGGCGAGCAGAACCGCATCATATTCTCGAGAATATGATGCGGTTCTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021290
UCN MISSION shRNA Bacterial Glycerol Stock
urocortin
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021290.2-364s21c1
Sequence:CCGGACTGTCCATCGACCTCACCTTCTCGAGAAGGTGAGGTCGATGGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021290.2-222s21c1
Sequence:CCGGAGGATCCGAATCTGCGATGGACTCGAGTCCATCGCAGATTCGGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021290.2-441s21c1
Sequence:CCGGCAGAGCAGAACCGCATCATATCTCGAGATATGATGCGGTTCTGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021290.2-463s21c1
Sequence:CCGGCGATTCGGTGGGCAAGTGATCCTCGAGGATCACTTGCCCACCGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021290.2-286s21c1
Sequence:CCGGCTTGCTGTTAGCGGAGCGCTTCTCGAGAAGCGCTCCGCTAACAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021290.1-441s1c1
Sequence:CCGGCAGAGCAGAACCGCATCATATCTCGAGATATGATGCGGTTCTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021290.1-443s1c1
Sequence:CCGGGAGCAGAACCGCATCATATTCCTCGAGGAATATGATGCGGTTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021290
UCN MISSION shRNA shRNA Plasmid DNA
urocortin
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021290.2-364s21c1
Sequence:CCGGACTGTCCATCGACCTCACCTTCTCGAGAAGGTGAGGTCGATGGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021290.2-222s21c1
Sequence:CCGGAGGATCCGAATCTGCGATGGACTCGAGTCCATCGCAGATTCGGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021290.2-441s21c1
Sequence:CCGGCAGAGCAGAACCGCATCATATCTCGAGATATGATGCGGTTCTGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021290.2-463s21c1
Sequence:CCGGCGATTCGGTGGGCAAGTGATCCTCGAGGATCACTTGCCCACCGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021290.2-286s21c1
Sequence:CCGGCTTGCTGTTAGCGGAGCGCTTCTCGAGAAGCGCTCCGCTAACAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021290.1-441s1c1
Sequence:CCGGCAGAGCAGAACCGCATCATATCTCGAGATATGATGCGGTTCTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021290.1-443s1c1
Sequence:CCGGGAGCAGAACCGCATCATATTCCTCGAGGAATATGATGCGGTTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021290
UCN MISSION shRNA Lentiviral Transduction Particles
urocortin
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021290.2-364s21c1
Sequence:CCGGACTGTCCATCGACCTCACCTTCTCGAGAAGGTGAGGTCGATGGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021290.2-222s21c1
Sequence:CCGGAGGATCCGAATCTGCGATGGACTCGAGTCCATCGCAGATTCGGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021290.2-441s21c1
Sequence:CCGGCAGAGCAGAACCGCATCATATCTCGAGATATGATGCGGTTCTGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021290.2-463s21c1
Sequence:CCGGCGATTCGGTGGGCAAGTGATCCTCGAGGATCACTTGCCCACCGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021290.2-286s21c1
Sequence:CCGGCTTGCTGTTAGCGGAGCGCTTCTCGAGAAGCGCTCCGCTAACAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021290.1-441s1c1
Sequence:CCGGCAGAGCAGAACCGCATCATATCTCGAGATATGATGCGGTTCTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021290.1-443s1c1
Sequence:CCGGGAGCAGAACCGCATCATATTCCTCGAGGAATATGATGCGGTTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks