EMAIL THIS PAGE TO A FRIEND

UCP1

uncoupling protein 1 (mitochondrial, proton carrier)

Synonyms: SLC25A7 UCP
UniProtKB ID: P25874, Q13218, Q4KMZ3, Q68G66
Gene ID:
Human(7350) Summary: Mitochondrial uncoupling proteins (UCP) are members of the family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed only in brown adipose tissue, a specialized tissue which functions to produce heat. [provided by RefSeq, Jul 2008]
Mouse(22227) uncoupling protein 1 (mitochondrial, proton carrier)
Rat(24860) uncoupling protein 1 (mitochondrial, proton carrier)
Zebrafish(83908) uncoupling protein 1
domestic cat(101089511) uncoupling protein 1 (mitochondrial, proton carrier)
dog(403574) uncoupling protein 1 (mitochondrial, proton carrier)
cow(281561) uncoupling protein 1 (mitochondrial, proton carrier)
domestic guinea pig(100722020) uncoupling protein 1 (mitochondrial, proton carrier)
naked mole-rat(101723752) uncoupling protein 1 (mitochondrial, proton carrier)
Domestic Rabbit(100328618) uncoupling protein 1 (mitochondrial, proton carrier)
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021833 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021833 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021833 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009463 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009463 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009463 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU051021 MISSION® esiRNA esiRNA human UCP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021833 Rosetta Predictions human pricing
NM_012682 Rosetta Predictions rat pricing
NM_009463 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021833 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355146 predicted 485
2 SASI_Hs01_00049384 predicted 436
3 SASI_Hs01_00049385 predicted 639
4 SASI_Hs01_00049386 predicted 692
5 SASI_Hs01_00049387 predicted 595
6 SASI_Hs02_00355147 predicted 626
7 SASI_Hs01_00049388 predicted 647
8 SASI_Hs01_00049390 predicted 266
9 SASI_Hs01_00049391 predicted 415
10 SASI_Hs01_00049393 predicted 491
11 SASI_Hs01_00049389 predicted 685
12 SASI_Hs01_00049392 predicted 282
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012682 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066287 predicted 645
2 SASI_Rn01_00066288 predicted 647
3 SASI_Rn02_00259977 predicted 375
4 SASI_Rn01_00066289 predicted 472
5 SASI_Rn01_00066290 predicted 660
6 SASI_Rn01_00066291 predicted 380
7 SASI_Rn01_00066292 predicted 816
8 SASI_Rn01_00066293 predicted 941
9 SASI_Rn01_00066295 predicted 883
10 SASI_Rn02_00259978 predicted 818
11 SASI_Rn01_00066294 predicted 484
12 SASI_Rn01_00066296 predicted 665
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009463 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067598 predicted 701
2 SASI_Mm01_00067599 predicted 519
3 SASI_Mm01_00067600 predicted 867
4 SASI_Mm02_00316186 predicted 371
5 SASI_Mm01_00067602 predicted 981
6 SASI_Mm01_00067603 predicted 427
7 SASI_Mm01_00067604 predicted 870
8 SASI_Mm01_00067605 predicted 526
9 SASI_Mm01_00067606 predicted 291
10 SASI_Mm01_00067607 predicted 788
11 SASI_Mm01_00067601 predicted 771
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021833
UCP1 MISSION shRNA Bacterial Glycerol Stock
uncoupling protein 1 (mitochondrial, proton carrier)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021833.3-269s1c1
Sequence:CCGGCGTCCAGTGTTATTAGGTATACTCGAGTATACCTAATAACACTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021833.3-879s1c1
Sequence:CCGGCAACTGTGCAATGAAAGTGTTCTCGAGAACACTTTCATTGCACAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021833.3-454s1c1
Sequence:CCGGCCTAGTTTAGGAAGCAAGATTCTCGAGAATCTTGCTTCCTAAACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021833.3-499s1c1
Sequence:CCGGGTGGCAGTATTCATTGGGCAACTCGAGTTGCCCAATGAATACTGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021833.3-602s1c1
Sequence:CCGGCGTACAGAATAATAGCAACAACTCGAGTTGTTGCTATTATTCTGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021833.4-641s21c1
Sequence:CCGGTGTACAGAGCTAGTAACATATCTCGAGATATGTTACTAGCTCTGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021833.4-980s21c1
Sequence:CCGGACTATGGACTGTGCCACATAACTCGAGTTATGTGGCACAGTCCATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021833.4-719s21c1
Sequence:CCGGCACTTGGTGTCGGCTCTTATCCTCGAGGATAAGAGCCGACACCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021833
UCP1 MISSION shRNA shRNA Plasmid DNA
uncoupling protein 1 (mitochondrial, proton carrier)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021833.3-269s1c1
Sequence:CCGGCGTCCAGTGTTATTAGGTATACTCGAGTATACCTAATAACACTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021833.3-879s1c1
Sequence:CCGGCAACTGTGCAATGAAAGTGTTCTCGAGAACACTTTCATTGCACAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021833.3-454s1c1
Sequence:CCGGCCTAGTTTAGGAAGCAAGATTCTCGAGAATCTTGCTTCCTAAACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021833.3-499s1c1
Sequence:CCGGGTGGCAGTATTCATTGGGCAACTCGAGTTGCCCAATGAATACTGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021833.3-602s1c1
Sequence:CCGGCGTACAGAATAATAGCAACAACTCGAGTTGTTGCTATTATTCTGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021833.4-641s21c1
Sequence:CCGGTGTACAGAGCTAGTAACATATCTCGAGATATGTTACTAGCTCTGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021833.4-980s21c1
Sequence:CCGGACTATGGACTGTGCCACATAACTCGAGTTATGTGGCACAGTCCATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021833.4-719s21c1
Sequence:CCGGCACTTGGTGTCGGCTCTTATCCTCGAGGATAAGAGCCGACACCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021833
UCP1 MISSION shRNA Lentiviral Transduction Particles
uncoupling protein 1 (mitochondrial, proton carrier)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021833.3-269s1c1
Sequence:CCGGCGTCCAGTGTTATTAGGTATACTCGAGTATACCTAATAACACTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021833.3-879s1c1
Sequence:CCGGCAACTGTGCAATGAAAGTGTTCTCGAGAACACTTTCATTGCACAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021833.3-454s1c1
Sequence:CCGGCCTAGTTTAGGAAGCAAGATTCTCGAGAATCTTGCTTCCTAAACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021833.3-499s1c1
Sequence:CCGGGTGGCAGTATTCATTGGGCAACTCGAGTTGCCCAATGAATACTGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021833.3-602s1c1
Sequence:CCGGCGTACAGAATAATAGCAACAACTCGAGTTGTTGCTATTATTCTGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021833.4-641s21c1
Sequence:CCGGTGTACAGAGCTAGTAACATATCTCGAGATATGTTACTAGCTCTGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021833.4-980s21c1
Sequence:CCGGACTATGGACTGTGCCACATAACTCGAGTTATGTGGCACAGTCCATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021833.4-719s21c1
Sequence:CCGGCACTTGGTGTCGGCTCTTATCCTCGAGGATAAGAGCCGACACCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009463
UCP1 MISSION shRNA Bacterial Glycerol Stock
uncoupling protein 1 (mitochondrial, proton carrier)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009463.2-726s1c1
Sequence:CCGGCCACCACAGAAAGCTTGTCAACTCGAGTTGACAAGCTTTCTGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009463.2-638s1c1
Sequence:CCGGGTCGTGAAGGTCAGAATGCAACTCGAGTTGCATTCTGACCTTCACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009463.2-872s1c1
Sequence:CCGGTGCCATTTACTGTCAGCTCTTCTCGAGAAGAGCTGACAGTAAATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009463.2-377s1c1
Sequence:CCGGGCTTCCAGTACCATTAGGTATCTCGAGATACCTAATGGTACTGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009463.2-1078s1c1
Sequence:CCGGCGTCATCATGTTTGTGTGCTTCTCGAGAAGCACACAAACATGATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444853    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009463.3-1200s21c1
Sequence:CCGGATGCTGGGAGACCACGAATAACTCGAGTTATTCGTGGTCTCCCAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009463.3-1139s21c1
Sequence:CCGGACAGTGGATTGTACCACATAACTCGAGTTATGTGGTACAATCCACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414884    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009463.3-1454s21c1
Sequence:CCGGGGAGTGTATGACTGGGTATAACTCGAGTTATACCCAGTCATACACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009463.3-800s21c1
Sequence:CCGGTGTACAGAGCTGGTAACATATCTCGAGATATGTTACCAGCTCTGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009463.3-580s21c1
Sequence:CCGGCAAGATCTCAGCCGGCTTAATCTCGAGATTAAGCCGGCTGAGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009463
UCP1 MISSION shRNA shRNA Plasmid DNA
uncoupling protein 1 (mitochondrial, proton carrier)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009463.2-726s1c1
Sequence:CCGGCCACCACAGAAAGCTTGTCAACTCGAGTTGACAAGCTTTCTGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009463.2-638s1c1
Sequence:CCGGGTCGTGAAGGTCAGAATGCAACTCGAGTTGCATTCTGACCTTCACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009463.2-872s1c1
Sequence:CCGGTGCCATTTACTGTCAGCTCTTCTCGAGAAGAGCTGACAGTAAATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009463.2-377s1c1
Sequence:CCGGGCTTCCAGTACCATTAGGTATCTCGAGATACCTAATGGTACTGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009463.2-1078s1c1
Sequence:CCGGCGTCATCATGTTTGTGTGCTTCTCGAGAAGCACACAAACATGATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444853    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009463.3-1200s21c1
Sequence:CCGGATGCTGGGAGACCACGAATAACTCGAGTTATTCGTGGTCTCCCAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009463.3-1139s21c1
Sequence:CCGGACAGTGGATTGTACCACATAACTCGAGTTATGTGGTACAATCCACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414884    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009463.3-1454s21c1
Sequence:CCGGGGAGTGTATGACTGGGTATAACTCGAGTTATACCCAGTCATACACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009463.3-800s21c1
Sequence:CCGGTGTACAGAGCTGGTAACATATCTCGAGATATGTTACCAGCTCTGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009463.3-580s21c1
Sequence:CCGGCAAGATCTCAGCCGGCTTAATCTCGAGATTAAGCCGGCTGAGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009463
UCP1 MISSION shRNA Lentiviral Transduction Particles
uncoupling protein 1 (mitochondrial, proton carrier)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009463.2-726s1c1
Sequence:CCGGCCACCACAGAAAGCTTGTCAACTCGAGTTGACAAGCTTTCTGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009463.2-638s1c1
Sequence:CCGGGTCGTGAAGGTCAGAATGCAACTCGAGTTGCATTCTGACCTTCACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009463.2-872s1c1
Sequence:CCGGTGCCATTTACTGTCAGCTCTTCTCGAGAAGAGCTGACAGTAAATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009463.2-377s1c1
Sequence:CCGGGCTTCCAGTACCATTAGGTATCTCGAGATACCTAATGGTACTGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009463.2-1078s1c1
Sequence:CCGGCGTCATCATGTTTGTGTGCTTCTCGAGAAGCACACAAACATGATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444853    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009463.3-1200s21c1
Sequence:CCGGATGCTGGGAGACCACGAATAACTCGAGTTATTCGTGGTCTCCCAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009463.3-1139s21c1
Sequence:CCGGACAGTGGATTGTACCACATAACTCGAGTTATGTGGTACAATCCACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414884    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009463.3-1454s21c1
Sequence:CCGGGGAGTGTATGACTGGGTATAACTCGAGTTATACCCAGTCATACACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009463.3-800s21c1
Sequence:CCGGTGTACAGAGCTGGTAACATATCTCGAGATATGTTACCAGCTCTGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009463.3-580s21c1
Sequence:CCGGCAAGATCTCAGCCGGCTTAATCTCGAGATTAAGCCGGCTGAGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks