EMAIL THIS PAGE TO A FRIEND

UCP2

uncoupling protein 2 (mitochondrial, proton carrier)

Synonyms: BMIQ4 SLC25A8 UCPH
UniProtKB ID: P55851, Q4PJH8, Q53HM3
Gene ID:
Human(7351) Summary: Mitochondrial uncoupling proteins (UCP) are members of the larger family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed in many tissues, with the greatest expression in skeletal muscle. It is thought to play a role in nonshivering thermogenesis, obesity and diabetes. Chromosomal order is 5'-UCP3-UCP2-3'. [provided by RefSeq, Jul 2008]
Mouse(22228) uncoupling protein 2 (mitochondrial, proton carrier)
Rat(54315) uncoupling protein 2 (mitochondrial, proton carrier)
naked mole-rat(101713667) uncoupling protein 2 (mitochondrial, proton carrier)
domestic guinea pig(100727277) uncoupling protein 2 (mitochondrial, proton carrier)
cow(281562) uncoupling protein 2 (mitochondrial, proton carrier)
sheep(641300) uncoupling protein 2 (mitochondrial, proton carrier)
sheep(101104932) uncoupling protein 2 (mitochondrial, proton carrier)
Thale Cress(836014) uncoupling protein 2
domestic cat(692194) uncoupling protein 2 (mitochondrial, proton carrier)
dog(403576) uncoupling protein 2 (mitochondrial, proton carrier)
Zebrafish(555812) uncoupling protein 2
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011671 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011671 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011671 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003355 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003355 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003355 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003355 Rosetta Predictions human pricing
NM_019354 Rosetta Predictions rat pricing
NM_011671 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003355 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116079 predicted 913
2 SASI_Hs02_00335504 predicted 983
3 SASI_Hs01_00116080 predicted 481
4 SASI_Hs01_00116081 predicted 667
5 SASI_Hs01_00116082 predicted 1007
6 SASI_Hs01_00116083 predicted 963
7 SASI_Hs01_00116084 predicted 543
8 SASI_Hs01_00116086 predicted 1011
9 SASI_Hs01_00116087 predicted 735
10 SASI_Hs01_00116088 predicted 923
11 SASI_Hs01_00116085 predicted 1097
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019354 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069267 predicted 535
2 SASI_Rn01_00069268 predicted 608
3 SASI_Rn01_00069269 predicted 580
4 SASI_Rn02_00262362 predicted 550
5 SASI_Rn02_00262363 predicted 400
6 SASI_Rn01_00069272 predicted 706
7 SASI_Rn01_00069273 predicted 637
8 SASI_Rn01_00069274 predicted 569
9 SASI_Rn01_00069276 predicted 630
10 SASI_Rn02_00262364 predicted 703
11 SASI_Rn01_00069270 predicted 410
12 SASI_Rn01_00069271 predicted 1237
13 SASI_Rn01_00069275 predicted 899
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011671 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088863 predicted 1231
2 SASI_Mm01_00088864 predicted 1576
3 SASI_Mm01_00088865 predicted 1685
4 SASI_Mm02_00321187 predicted 1573
5 SASI_Mm01_00088866 predicted 1005
6 SASI_Mm01_00088867 predicted 1268
7 SASI_Mm01_00088868 predicted 1262
8 SASI_Mm01_00088869 predicted 1557
9 SASI_Mm01_00088871 predicted 777
10 SASI_Mm01_00088872 predicted 962
11 SASI_Mm01_00088870 predicted 1668
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011671
VALIDATED
UCP2 MISSION shRNA Bacterial Glycerol Stock
uncoupling protein 2 (mitochondrial, proton carrier)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011671.4-1086s21c1
Sequence:CCGGGATGTGGTCAAGACGAGATACCTCGAGGTATCTCGTCTTGACCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011671.4-918s21c1
Sequence:CCGGTCTCCCAATGTTGCCCGTAATCTCGAGATTACGGGCAACATTGGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011671.4-781s21c1
Sequence:CCGGCCCAGCCTACAGATGTGGTAACTCGAGTTACCACATCTGTAGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319572    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011671.4-1552s21c1
Sequence:CCGGAGCCAGCCTTCACCCATAAAGCTCGAGCTTTATGGGTGAAGGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011671.4-1232s21c1
Sequence:CCGGCGTAGTGATGTTTGTCACCTACTCGAGTAGGTGACAAACATCACTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114251    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011671.2-3646s1c1
Sequence:CCGGGCACAGTAACATGCAGGCAAACTCGAGTTTGCCTGCATGTTACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011671.2-763s1c1
Sequence:CCGGCCCAGCCTACAGATGTGGTAACTCGAGTTACCACATCTGTAGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011671.2-900s1c1
Sequence:CCGGTCTCCCAATGTTGCCCGTAATCTCGAGATTACGGGCAACATTGGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011671.2-764s1c1
Sequence:CCGGCCAGCCTACAGATGTGGTAAACTCGAGTTTACCACATCTGTAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011671.2-1214s1c1
Sequence:CCGGCGTAGTGATGTTTGTCACCTACTCGAGTAGGTGACAAACATCACTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011671
VALIDATED
UCP2 MISSION shRNA shRNA Plasmid DNA
uncoupling protein 2 (mitochondrial, proton carrier)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011671.4-1086s21c1
Sequence:CCGGGATGTGGTCAAGACGAGATACCTCGAGGTATCTCGTCTTGACCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011671.4-918s21c1
Sequence:CCGGTCTCCCAATGTTGCCCGTAATCTCGAGATTACGGGCAACATTGGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011671.4-781s21c1
Sequence:CCGGCCCAGCCTACAGATGTGGTAACTCGAGTTACCACATCTGTAGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319572    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011671.4-1552s21c1
Sequence:CCGGAGCCAGCCTTCACCCATAAAGCTCGAGCTTTATGGGTGAAGGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011671.4-1232s21c1
Sequence:CCGGCGTAGTGATGTTTGTCACCTACTCGAGTAGGTGACAAACATCACTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114251    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011671.2-3646s1c1
Sequence:CCGGGCACAGTAACATGCAGGCAAACTCGAGTTTGCCTGCATGTTACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011671.2-763s1c1
Sequence:CCGGCCCAGCCTACAGATGTGGTAACTCGAGTTACCACATCTGTAGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011671.2-900s1c1
Sequence:CCGGTCTCCCAATGTTGCCCGTAATCTCGAGATTACGGGCAACATTGGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011671.2-764s1c1
Sequence:CCGGCCAGCCTACAGATGTGGTAAACTCGAGTTTACCACATCTGTAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011671.2-1214s1c1
Sequence:CCGGCGTAGTGATGTTTGTCACCTACTCGAGTAGGTGACAAACATCACTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011671
VALIDATED
UCP2 MISSION shRNA Lentiviral Transduction Particles
uncoupling protein 2 (mitochondrial, proton carrier)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011671.4-1086s21c1
Sequence:CCGGGATGTGGTCAAGACGAGATACCTCGAGGTATCTCGTCTTGACCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011671.4-918s21c1
Sequence:CCGGTCTCCCAATGTTGCCCGTAATCTCGAGATTACGGGCAACATTGGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011671.4-781s21c1
Sequence:CCGGCCCAGCCTACAGATGTGGTAACTCGAGTTACCACATCTGTAGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319572    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011671.4-1552s21c1
Sequence:CCGGAGCCAGCCTTCACCCATAAAGCTCGAGCTTTATGGGTGAAGGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011671.4-1232s21c1
Sequence:CCGGCGTAGTGATGTTTGTCACCTACTCGAGTAGGTGACAAACATCACTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114251    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011671.2-3646s1c1
Sequence:CCGGGCACAGTAACATGCAGGCAAACTCGAGTTTGCCTGCATGTTACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011671.2-763s1c1
Sequence:CCGGCCCAGCCTACAGATGTGGTAACTCGAGTTACCACATCTGTAGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011671.2-900s1c1
Sequence:CCGGTCTCCCAATGTTGCCCGTAATCTCGAGATTACGGGCAACATTGGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011671.2-764s1c1
Sequence:CCGGCCAGCCTACAGATGTGGTAAACTCGAGTTTACCACATCTGTAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011671.2-1214s1c1
Sequence:CCGGCGTAGTGATGTTTGTCACCTACTCGAGTAGGTGACAAACATCACTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003355
VALIDATED
UCP2 MISSION shRNA Bacterial Glycerol Stock
uncoupling protein 2 (mitochondrial, proton carrier)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003355.2-1088s21c1
Sequence:CCGGCGTGGTCAAGACGAGATACATCTCGAGATGTATCTCGTCTTGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003355.2-498s21c1
Sequence:CCGGCGGTTACAGATCCAAGGAGAACTCGAGTTCTCCTTGGATCTGTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003355.2-474s21c1
Sequence:CCGGTTTCCTCTGGATACTGCTAAACTCGAGTTTAGCAGTATCCAGAGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003355.2-412s21c1
Sequence:CCGGCTACTGCCACTGTGAAGTTTCCTCGAGGAAACTTCACAGTGGCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303634    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003355.2-1425s21c1
Sequence:CCGGCCTCTTCCTTCCGCTCCTTTACTCGAGTAAAGGAGCGGAAGGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003355.2-498s1c1
Sequence:CCGGCGGTTACAGATCCAAGGAGAACTCGAGTTCTCCTTGGATCTGTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003355.2-842s1c1
Sequence:CCGGGAGATACCAAAGCACCGTCAACTCGAGTTGACGGTGCTTTGGTATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003355.2-1088s1c1
Sequence:CCGGCGTGGTCAAGACGAGATACATCTCGAGATGTATCTCGTCTTGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003355.2-918s1c1
Sequence:CCGGTCTCCCAATGTTGCTCGTAATCTCGAGATTACGAGCAACATTGGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003355.2-671s1c1
Sequence:CCGGCGGCCTGTATGATTCTGTCAACTCGAGTTGACAGAATCATACAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003355
VALIDATED
UCP2 MISSION shRNA shRNA Plasmid DNA
uncoupling protein 2 (mitochondrial, proton carrier)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003355.2-1088s21c1
Sequence:CCGGCGTGGTCAAGACGAGATACATCTCGAGATGTATCTCGTCTTGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003355.2-498s21c1
Sequence:CCGGCGGTTACAGATCCAAGGAGAACTCGAGTTCTCCTTGGATCTGTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003355.2-474s21c1
Sequence:CCGGTTTCCTCTGGATACTGCTAAACTCGAGTTTAGCAGTATCCAGAGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003355.2-412s21c1
Sequence:CCGGCTACTGCCACTGTGAAGTTTCCTCGAGGAAACTTCACAGTGGCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303634    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003355.2-1425s21c1
Sequence:CCGGCCTCTTCCTTCCGCTCCTTTACTCGAGTAAAGGAGCGGAAGGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003355.2-498s1c1
Sequence:CCGGCGGTTACAGATCCAAGGAGAACTCGAGTTCTCCTTGGATCTGTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003355.2-842s1c1
Sequence:CCGGGAGATACCAAAGCACCGTCAACTCGAGTTGACGGTGCTTTGGTATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003355.2-1088s1c1
Sequence:CCGGCGTGGTCAAGACGAGATACATCTCGAGATGTATCTCGTCTTGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003355.2-918s1c1
Sequence:CCGGTCTCCCAATGTTGCTCGTAATCTCGAGATTACGAGCAACATTGGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003355.2-671s1c1
Sequence:CCGGCGGCCTGTATGATTCTGTCAACTCGAGTTGACAGAATCATACAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003355
VALIDATED
UCP2 MISSION shRNA Lentiviral Transduction Particles
uncoupling protein 2 (mitochondrial, proton carrier)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000299392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003355.2-1088s21c1
Sequence:CCGGCGTGGTCAAGACGAGATACATCTCGAGATGTATCTCGTCTTGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003355.2-498s21c1
Sequence:CCGGCGGTTACAGATCCAAGGAGAACTCGAGTTCTCCTTGGATCTGTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003355.2-474s21c1
Sequence:CCGGTTTCCTCTGGATACTGCTAAACTCGAGTTTAGCAGTATCCAGAGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003355.2-412s21c1
Sequence:CCGGCTACTGCCACTGTGAAGTTTCCTCGAGGAAACTTCACAGTGGCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303634    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003355.2-1425s21c1
Sequence:CCGGCCTCTTCCTTCCGCTCCTTTACTCGAGTAAAGGAGCGGAAGGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003355.2-498s1c1
Sequence:CCGGCGGTTACAGATCCAAGGAGAACTCGAGTTCTCCTTGGATCTGTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003355.2-842s1c1
Sequence:CCGGGAGATACCAAAGCACCGTCAACTCGAGTTGACGGTGCTTTGGTATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003355.2-1088s1c1
Sequence:CCGGCGTGGTCAAGACGAGATACATCTCGAGATGTATCTCGTCTTGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003355.2-918s1c1
Sequence:CCGGTCTCCCAATGTTGCTCGTAATCTCGAGATTACGAGCAACATTGGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003355.2-671s1c1
Sequence:CCGGCGGCCTGTATGATTCTGTCAACTCGAGTTGACAGAATCATACAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks