EMAIL THIS PAGE TO A FRIEND

UCP3

uncoupling protein 3 (mitochondrial, proton carrier)

Synonyms: SLC25A9
UniProtKB ID: P55916, O60475, Q96HL3
Gene ID:
Human(7352) Summary: Mitochondrial uncoupling proteins (UCP) are members of the larger family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. The different UCPs have tissue-specific expression; this gene is primarily expressed in skeletal muscle. This gene's protein product is postulated to protect mitochondria against lipid-induced oxidative stress. Expression levels of this gene increase when fatty acid supplies to mitochondria exceed their oxidation capacity and the protein enables the export of fatty acids from mitochondria. UCPs contain the three solcar protein domains typically found in MACPs. Two splice variants have been found for this gene.[provided by RefSeq, Nov 2008]
Mouse(22229) uncoupling protein 3 (mitochondrial, proton carrier)
Rat(25708) uncoupling protein 3 (mitochondrial, proton carrier)
Zebrafish(794081) uncoupling protein 3
dog(403575) uncoupling protein 3 (mitochondrial, proton carrier)
chicken(373896) uncoupling protein 3 (mitochondrial, proton carrier)
domestic cat(101095610) uncoupling protein 3 (mitochondrial, proton carrier)
cow(281563) uncoupling protein 3 (mitochondrial, proton carrier)
sheep(443278) uncoupling protein 3 (mitochondrial, proton carrier)
domestic guinea pig(100726996) uncoupling protein 3 (mitochondrial, proton carrier)
naked mole-rat(101713308) uncoupling protein 3 (mitochondrial, proton carrier)
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003356 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003356 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003356 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009464 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009464 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009464 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU073081 MISSION® esiRNA esiRNA human UCP3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003356 Rosetta Predictions human pricing
NM_022803 Rosetta Predictions human pricing
NM_013167 Rosetta Predictions rat pricing
NM_009464 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003356 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119026 predicted 532
2 SASI_Hs01_00119027 predicted 490
3 SASI_Hs01_00119028 predicted 349
4 SASI_Hs01_00119029 predicted 543
5 SASI_Hs01_00119030 predicted 527
6 SASI_Hs02_00335505 predicted 472
7 SASI_Hs01_00119031 predicted 484
8 SASI_Hs01_00119032 predicted 493
9 SASI_Hs01_00119033 predicted 603
10 SASI_Hs01_00119034 predicted 576
11 SASI_Hs01_00119035 predicted 467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022803 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193507 predicted 533
2 SASI_Hs01_00193508 predicted 482
3 SASI_Hs01_00193509 predicted 351
4 SASI_Hs01_00193510 predicted 536
5 SASI_Hs01_00193511 predicted 532
6 SASI_Hs02_00356102 predicted 477
7 SASI_Hs01_00193512 predicted 488
8 SASI_Hs01_00193513 predicted 490
9 SASI_Hs01_00193514 predicted 604
10 SASI_Hs01_00193515 predicted 576
11 SASI_Hs01_00193516 predicted 466
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013167 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086032 predicted 1501
2 SASI_Rn01_00086033 predicted 1167
3 SASI_Rn01_00086034 predicted 1414
4 SASI_Rn01_00086035 predicted 668
5 SASI_Rn01_00086036 predicted 1383
6 SASI_Rn01_00086037 predicted 1510
7 SASI_Rn01_00086038 predicted 1069
8 SASI_Rn02_00260990 predicted 1295
9 SASI_Rn01_00086039 predicted 1210
10 SASI_Rn01_00086040 predicted 827
11 SASI_Rn01_00086041 predicted 1021
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009464 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316187 predicted 1032
2 SASI_Mm01_00115110 predicted 1606
3 SASI_Mm01_00115112 predicted 1396
4 SASI_Mm01_00115114 predicted 1507
5 SASI_Mm01_00115115 predicted 761
6 SASI_Mm01_00115116 predicted 1558
7 SASI_Mm01_00115117 predicted 1590
8 SASI_Mm01_00115118 predicted 903
9 SASI_Mm01_00115119 predicted 1400
10 SASI_Mm02_00316188 predicted 1080
11 SASI_Mm01_00115111 predicted 1457
12 SASI_Mm01_00115113 predicted 742
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003356
VALIDATED
UCP3 MISSION shRNA Bacterial Glycerol Stock
uncoupling protein 3 (mitochondrial, proton carrier)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003356.2-971s1c1
Sequence:CCGGCCTCGACTGTATGATAAAGATCTCGAGATCTTTATCATACAGTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003356.2-1103s1c1
Sequence:CCGGCCTGATGAAAGTCCAGATGTTCTCGAGAACATCTGGACTTTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003356.2-761s1c1
Sequence:CCGGCATGAGGAATGCTATCGTCAACTCGAGTTGACGATAGCATTCCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003356.2-1022s1c1
Sequence:CCGGCAAGGGATTTACACCCTCCTTCTCGAGAAGGAGGGTGTAAATCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003356.2-544s1c1
Sequence:CCGGCCAGCCTCACTACCCGGATTTCTCGAGAAATCCGGGTAGTGAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003356.2-1105s21c1
Sequence:GTACCGGTGATGAAAGTCCAGATGTTACCTCGAGGTAACATCTGGACTTTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229767    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003356.2-1474s21c1
Sequence:CCGGCCGTGAAATCTGGTTAGATAACTCGAGTTATCTAACCAGATTTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003356.2-920s21c1
Sequence:CCGGCGTGGTGAAGACCCGGTATATCTCGAGATATACCGGGTCTTCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003356.2-763s21c1
Sequence:CCGGTGAGGAATGCTATCGTCAACTCTCGAGAGTTGACGATAGCATTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003356.2-616s21c1
Sequence:CCGGATGTGGTGAAGGTCCGATTTCCTCGAGGAAATCGGACCTTCACCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003356
VALIDATED
UCP3 MISSION shRNA shRNA Plasmid DNA
uncoupling protein 3 (mitochondrial, proton carrier)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003356.2-971s1c1
Sequence:CCGGCCTCGACTGTATGATAAAGATCTCGAGATCTTTATCATACAGTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003356.2-1103s1c1
Sequence:CCGGCCTGATGAAAGTCCAGATGTTCTCGAGAACATCTGGACTTTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003356.2-761s1c1
Sequence:CCGGCATGAGGAATGCTATCGTCAACTCGAGTTGACGATAGCATTCCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003356.2-1022s1c1
Sequence:CCGGCAAGGGATTTACACCCTCCTTCTCGAGAAGGAGGGTGTAAATCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003356.2-544s1c1
Sequence:CCGGCCAGCCTCACTACCCGGATTTCTCGAGAAATCCGGGTAGTGAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003356.2-1105s21c1
Sequence:GTACCGGTGATGAAAGTCCAGATGTTACCTCGAGGTAACATCTGGACTTTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229767    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003356.2-1474s21c1
Sequence:CCGGCCGTGAAATCTGGTTAGATAACTCGAGTTATCTAACCAGATTTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003356.2-920s21c1
Sequence:CCGGCGTGGTGAAGACCCGGTATATCTCGAGATATACCGGGTCTTCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003356.2-763s21c1
Sequence:CCGGTGAGGAATGCTATCGTCAACTCTCGAGAGTTGACGATAGCATTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003356.2-616s21c1
Sequence:CCGGATGTGGTGAAGGTCCGATTTCCTCGAGGAAATCGGACCTTCACCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003356
VALIDATED
UCP3 MISSION shRNA Lentiviral Transduction Particles
uncoupling protein 3 (mitochondrial, proton carrier)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003356.2-971s1c1
Sequence:CCGGCCTCGACTGTATGATAAAGATCTCGAGATCTTTATCATACAGTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003356.2-1103s1c1
Sequence:CCGGCCTGATGAAAGTCCAGATGTTCTCGAGAACATCTGGACTTTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003356.2-761s1c1
Sequence:CCGGCATGAGGAATGCTATCGTCAACTCGAGTTGACGATAGCATTCCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003356.2-1022s1c1
Sequence:CCGGCAAGGGATTTACACCCTCCTTCTCGAGAAGGAGGGTGTAAATCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003356.2-544s1c1
Sequence:CCGGCCAGCCTCACTACCCGGATTTCTCGAGAAATCCGGGTAGTGAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003356.2-1105s21c1
Sequence:GTACCGGTGATGAAAGTCCAGATGTTACCTCGAGGTAACATCTGGACTTTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229767    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003356.2-1474s21c1
Sequence:CCGGCCGTGAAATCTGGTTAGATAACTCGAGTTATCTAACCAGATTTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003356.2-920s21c1
Sequence:CCGGCGTGGTGAAGACCCGGTATATCTCGAGATATACCGGGTCTTCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003356.2-763s21c1
Sequence:CCGGTGAGGAATGCTATCGTCAACTCTCGAGAGTTGACGATAGCATTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003356.2-616s21c1
Sequence:CCGGATGTGGTGAAGGTCCGATTTCCTCGAGGAAATCGGACCTTCACCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009464
UCP3 MISSION shRNA Bacterial Glycerol Stock
uncoupling protein 3 (mitochondrial, proton carrier)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009464.2-1083s1c1
Sequence:CCGGGCCTTAATGAAAGTCCAGGTACTCGAGTACCTGGACTTTCATTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009464.2-840s1c1
Sequence:CCGGTGTCACTTTGTCTCTGCCTTTCTCGAGAAAGGCAGAGACAAAGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114266    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009464.2-1384s1c1
Sequence:CCGGCCCTTGAAATGTAGGAATAAACTCGAGTTTATTCCTACATTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009464.2-224s1c1
Sequence:CCGGGCCTCCCACAACGGTTGTGAACTCGAGTTCACAACCGTTGTGGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009464.2-1038s1c1
Sequence:CCGGGCTTGGAACGTGATGATGTTTCTCGAGAAACATCATCACGTTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009464.3-654s21c1
Sequence:CCGGAGGAAATACAGAGGGACTATGCTCGAGCATAGTCCCTCTGTATTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009464.3-613s21c1
Sequence:CCGGTCCGATTTCAAGCCATGATACCTCGAGGTATCATGGCTTGAAATCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424441    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009464.3-1204s21c1
Sequence:CCGGACTGCTGCTGACACGAGAAACCTCGAGGTTTCTCGTGTCAGCAGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009464
UCP3 MISSION shRNA shRNA Plasmid DNA
uncoupling protein 3 (mitochondrial, proton carrier)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009464.2-1083s1c1
Sequence:CCGGGCCTTAATGAAAGTCCAGGTACTCGAGTACCTGGACTTTCATTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009464.2-840s1c1
Sequence:CCGGTGTCACTTTGTCTCTGCCTTTCTCGAGAAAGGCAGAGACAAAGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114266    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009464.2-1384s1c1
Sequence:CCGGCCCTTGAAATGTAGGAATAAACTCGAGTTTATTCCTACATTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009464.2-224s1c1
Sequence:CCGGGCCTCCCACAACGGTTGTGAACTCGAGTTCACAACCGTTGTGGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009464.2-1038s1c1
Sequence:CCGGGCTTGGAACGTGATGATGTTTCTCGAGAAACATCATCACGTTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009464.3-654s21c1
Sequence:CCGGAGGAAATACAGAGGGACTATGCTCGAGCATAGTCCCTCTGTATTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009464.3-613s21c1
Sequence:CCGGTCCGATTTCAAGCCATGATACCTCGAGGTATCATGGCTTGAAATCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424441    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009464.3-1204s21c1
Sequence:CCGGACTGCTGCTGACACGAGAAACCTCGAGGTTTCTCGTGTCAGCAGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009464
UCP3 MISSION shRNA Lentiviral Transduction Particles
uncoupling protein 3 (mitochondrial, proton carrier)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009464.2-1083s1c1
Sequence:CCGGGCCTTAATGAAAGTCCAGGTACTCGAGTACCTGGACTTTCATTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009464.2-840s1c1
Sequence:CCGGTGTCACTTTGTCTCTGCCTTTCTCGAGAAAGGCAGAGACAAAGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114266    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009464.2-1384s1c1
Sequence:CCGGCCCTTGAAATGTAGGAATAAACTCGAGTTTATTCCTACATTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009464.2-224s1c1
Sequence:CCGGGCCTCCCACAACGGTTGTGAACTCGAGTTCACAACCGTTGTGGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009464.2-1038s1c1
Sequence:CCGGGCTTGGAACGTGATGATGTTTCTCGAGAAACATCATCACGTTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009464.3-654s21c1
Sequence:CCGGAGGAAATACAGAGGGACTATGCTCGAGCATAGTCCCTCTGTATTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009464.3-613s21c1
Sequence:CCGGTCCGATTTCAAGCCATGATACCTCGAGGTATCATGGCTTGAAATCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424441    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009464.3-1204s21c1
Sequence:CCGGACTGCTGCTGACACGAGAAACCTCGAGGTTTCTCGTGTCAGCAGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks