EMAIL THIS PAGE TO A FRIEND

UEVLD

UEV and lactate/malate dehyrogenase domains

Synonyms: ATTP UEV3
Gene ID:
Mouse(54122) UEV and lactate/malate dehyrogenase domains
Rat(691172) UEV and lactate/malate dehyrogenase domains
Zebrafish(445225) UEV and lactate/malate dehyrogenase domains
dog(612008) UEV and lactate/malate dehyrogenase domains
Horse(100057140) UEV and lactate/malate dehyrogenase domains
domestic cat(101101163) UEV and lactate/malate dehyrogenase domains
chicken(100858486) UEV and lactate/malate dehyrogenase domains
cow(512846) UEV and lactate/malate dehyrogenase domains
sheep(101117027) UEV and lactate/malate dehyrogenase domains
naked mole-rat(101716271) UEV and lactate/malate dehyrogenase domains
domestic guinea pig(100712869) UEV and lactate/malate dehyrogenase domains
140 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018314 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018314 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018314 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016855 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016855 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016855 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040697 Rosetta Predictions human pricing
NM_001040698 Rosetta Predictions human pricing
NM_018314 Rosetta Predictions human pricing
XM_001077088 Rosetta Predictions rat pricing
NM_001040695 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040697 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049331 predicted 253
2 SASI_Hs01_00049334 predicted 265
3 SASI_Hs01_00049335 predicted 286
4 SASI_Hs02_00309052 predicted 216
5 SASI_Hs02_00309053 predicted 534
6 SASI_Hs02_00309054 predicted 772
7 SASI_Hs02_00309055 predicted 858
8 SASI_Hs02_00309056 predicted 663
9 SASI_Hs02_00309057 predicted 1576
10 SASI_Hs02_00309058 predicted 245
11 SASI_Hs01_00049329 predicted 432
12 SASI_Hs01_00049330 predicted 271
13 SASI_Hs01_00049332 predicted 472
14 SASI_Hs01_00049333 predicted 399
15 SASI_Hs01_00049336 predicted 244
16 SASI_Hs01_00049337 predicted 257
17 SASI_Hs01_00049338 predicted 263
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040698 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097166 predicted 440
2 SASI_Hs01_00097167 predicted 273
3 SASI_Hs01_00097168 predicted 268
4 SASI_Hs01_00097169 predicted 470
5 SASI_Hs01_00097170 predicted 402
6 SASI_Hs01_00097171 predicted 261
7 SASI_Hs01_00097172 predicted 296
8 SASI_Hs01_00097173 predicted 249
9 SASI_Hs01_00097174 predicted 257
10 SASI_Hs01_00097175 predicted 263
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018314 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132851 predicted 257
2 SASI_Hs01_00132854 predicted 263
3 SASI_Hs01_00132855 predicted 282
4 SASI_Hs02_00351728 predicted 224
5 SASI_Hs02_00351729 predicted 527
6 SASI_Hs02_00351730 predicted 822
7 SASI_Hs02_00351731 predicted 774
8 SASI_Hs02_00351732 predicted 859
9 SASI_Hs02_00351733 predicted 664
10 SASI_Hs02_00351734 predicted 250
11 SASI_Hs01_00132849 predicted 436
12 SASI_Hs01_00132850 predicted 270
13 SASI_Hs01_00132852 predicted 470
14 SASI_Hs01_00132853 predicted 405
15 SASI_Hs01_00132856 predicted 245
16 SASI_Hs01_00132857 predicted 251
17 SASI_Hs01_00132858 predicted 260
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077088 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00355726 predicted 1583
2 SASI_Rn02_00355727 predicted 1792
3 SASI_Rn02_00355728 predicted 1325
4 SASI_Rn02_00355729 predicted 1480
5 SASI_Rn02_00355730 predicted 1668
6 SASI_Rn02_00355731 predicted 1367
7 SASI_Rn02_00355732 predicted 1596
8 SASI_Rn02_00355733 predicted 1296
9 SASI_Rn02_00355734 predicted 1827
10 SASI_Rn02_00355735 predicted 1604
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040695 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190699 predicted 445
2 SASI_Mm01_00190700 predicted 1234
3 SASI_Mm01_00190702 predicted 236
4 SASI_Mm01_00190703 predicted 814
5 SASI_Mm02_00290353 predicted 1241
6 SASI_Mm01_00190704 predicted 1272
7 SASI_Mm01_00190705 predicted 261
8 SASI_Mm01_00190706 predicted 1298
9 SASI_Mm01_00190707 predicted 252
10 SASI_Mm01_00190708 predicted 1303
11 SASI_Mm01_00190701 predicted 779
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018314
VALIDATED
UEVLD MISSION shRNA Bacterial Glycerol Stock
UEV and lactate/malate dehyrogenase domains
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_018314.3-1011s21c1
Sequence:CCGGGCAAATCGAGTGATCGGAATTCTCGAGAATTCCGATCACTCGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_018314.3-1677s21c1
Sequence:CCGGATTCATACTTCGGGAATATTTCTCGAGAAATATTCCCGAAGTATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018314.3-477s21c1
Sequence:CCGGGCCAAGTTTCAAGAGGAACTTCTCGAGAAGTTCCTCTTGAAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018314.3-258s21c1
Sequence:CCGGCCTGTGATGTATCAGGGTAATCTCGAGATTACCCTGATACATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007717    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018314.2-1457s1c1
Sequence:CCGGGCTTGGTTAAAGTAGAGGGTTCTCGAGAACCCTCTACTTTAACCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018314.2-449s1c1
Sequence:CCGGGCCAAGTTTCAAGAGGAACTTCTCGAGAAGTTCCTCTTGAAACTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_018314.2-570s1c1
Sequence:CCGGGCTGGGCAAATCATGAGAATACTCGAGTATTCTCATGATTTGCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018314.2-983s1c1
Sequence:CCGGGCAAATCGAGTGATCGGAATTCTCGAGAATTCCGATCACTCGATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_018314.2-230s1c1
Sequence:CCGGCCTGTGATGTATCAGGGTAATCTCGAGATTACCCTGATACATCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018314
VALIDATED
UEVLD MISSION shRNA shRNA Plasmid DNA
UEV and lactate/malate dehyrogenase domains
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_018314.3-1011s21c1
Sequence:CCGGGCAAATCGAGTGATCGGAATTCTCGAGAATTCCGATCACTCGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_018314.3-1677s21c1
Sequence:CCGGATTCATACTTCGGGAATATTTCTCGAGAAATATTCCCGAAGTATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018314.3-477s21c1
Sequence:CCGGGCCAAGTTTCAAGAGGAACTTCTCGAGAAGTTCCTCTTGAAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018314.3-258s21c1
Sequence:CCGGCCTGTGATGTATCAGGGTAATCTCGAGATTACCCTGATACATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007717    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018314.2-1457s1c1
Sequence:CCGGGCTTGGTTAAAGTAGAGGGTTCTCGAGAACCCTCTACTTTAACCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018314.2-449s1c1
Sequence:CCGGGCCAAGTTTCAAGAGGAACTTCTCGAGAAGTTCCTCTTGAAACTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_018314.2-570s1c1
Sequence:CCGGGCTGGGCAAATCATGAGAATACTCGAGTATTCTCATGATTTGCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018314.2-983s1c1
Sequence:CCGGGCAAATCGAGTGATCGGAATTCTCGAGAATTCCGATCACTCGATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_018314.2-230s1c1
Sequence:CCGGCCTGTGATGTATCAGGGTAATCTCGAGATTACCCTGATACATCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018314
VALIDATED
UEVLD MISSION shRNA Lentiviral Transduction Particles
UEV and lactate/malate dehyrogenase domains
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_018314.3-1011s21c1
Sequence:CCGGGCAAATCGAGTGATCGGAATTCTCGAGAATTCCGATCACTCGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_018314.3-1677s21c1
Sequence:CCGGATTCATACTTCGGGAATATTTCTCGAGAAATATTCCCGAAGTATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018314.3-477s21c1
Sequence:CCGGGCCAAGTTTCAAGAGGAACTTCTCGAGAAGTTCCTCTTGAAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018314.3-258s21c1
Sequence:CCGGCCTGTGATGTATCAGGGTAATCTCGAGATTACCCTGATACATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007717    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018314.2-1457s1c1
Sequence:CCGGGCTTGGTTAAAGTAGAGGGTTCTCGAGAACCCTCTACTTTAACCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018314.2-449s1c1
Sequence:CCGGGCCAAGTTTCAAGAGGAACTTCTCGAGAAGTTCCTCTTGAAACTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_018314.2-570s1c1
Sequence:CCGGGCTGGGCAAATCATGAGAATACTCGAGTATTCTCATGATTTGCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018314.2-983s1c1
Sequence:CCGGGCAAATCGAGTGATCGGAATTCTCGAGAATTCCGATCACTCGATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_018314.2-230s1c1
Sequence:CCGGCCTGTGATGTATCAGGGTAATCTCGAGATTACCCTGATACATCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016855
VALIDATED
UEVLD MISSION shRNA Bacterial Glycerol Stock
UEV and lactate/malate dehyrogenase domains
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016855.1-310s1c1
Sequence:CCGGGCCAACTGCAAACATGGAAATCTCGAGATTTCCATGTTTGCAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016855.1-115s1c1
Sequence:CCGGGAAGAATGTGAGCGTGTCTTTCTCGAGAAAGACACGCTCACATTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016855.1-478s1c1
Sequence:CCGGCCGTCGTCCAATGAAGCGCAACTCGAGTTGCGCTTCATTGGACGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016855.1-196s1c1
Sequence:CCGGGCTGAATTTCACCGGTACAATCTCGAGATTGTACCGGTGAAATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016855.1-457s1c1
Sequence:CCGGTCCTCTCTATTCCATACCATACTCGAGTATGGTATGGAATAGAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016855
VALIDATED
UEVLD MISSION shRNA shRNA Plasmid DNA
UEV and lactate/malate dehyrogenase domains
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016855.1-310s1c1
Sequence:CCGGGCCAACTGCAAACATGGAAATCTCGAGATTTCCATGTTTGCAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016855.1-115s1c1
Sequence:CCGGGAAGAATGTGAGCGTGTCTTTCTCGAGAAAGACACGCTCACATTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016855.1-478s1c1
Sequence:CCGGCCGTCGTCCAATGAAGCGCAACTCGAGTTGCGCTTCATTGGACGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016855.1-196s1c1
Sequence:CCGGGCTGAATTTCACCGGTACAATCTCGAGATTGTACCGGTGAAATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016855.1-457s1c1
Sequence:CCGGTCCTCTCTATTCCATACCATACTCGAGTATGGTATGGAATAGAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016855
VALIDATED
UEVLD MISSION shRNA Lentiviral Transduction Particles
UEV and lactate/malate dehyrogenase domains
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016855.1-310s1c1
Sequence:CCGGGCCAACTGCAAACATGGAAATCTCGAGATTTCCATGTTTGCAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016855.1-115s1c1
Sequence:CCGGGAAGAATGTGAGCGTGTCTTTCTCGAGAAAGACACGCTCACATTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016855.1-478s1c1
Sequence:CCGGCCGTCGTCCAATGAAGCGCAACTCGAGTTGCGCTTCATTGGACGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016855.1-196s1c1
Sequence:CCGGGCTGAATTTCACCGGTACAATCTCGAGATTGTACCGGTGAAATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016855.1-457s1c1
Sequence:CCGGTCCTCTCTATTCCATACCATACTCGAGTATGGTATGGAATAGAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks