EMAIL THIS PAGE TO A FRIEND

UFC1

ubiquitin-fold modifier conjugating enzyme 1

Synonyms: HSPC155
Gene ID:
Human(51506) Summary: UFC1 is an E2-like conjugating enzyme for ubiquitin-fold modifier-1 (UFM1; MIM 610553) (Komatsu et al., 2004 [PubMed 15071506]
Mouse(66155) ubiquitin-fold modifier conjugating enzyme 1
Rat(445268) ubiquitin-fold modifier conjugating enzyme 1
Zebrafish(445256) ubiquitin-fold modifier conjugating enzyme 1
dog(478978) ubiquitin-fold modifier conjugating enzyme 1
domestic cat(101091171) ubiquitin-fold modifier conjugating enzyme 1
domestic guinea pig(100735079) ubiquitin-fold modifier conjugating enzyme 1
naked mole-rat(101705223) ubiquitin-fold modifier conjugating enzyme 1
cow(537221) ubiquitin-fold modifier conjugating enzyme 1
sheep(101102771) ubiquitin-fold modifier conjugating enzyme 1
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016406 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016406 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016406 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025388 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025388 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025388 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016406 Rosetta Predictions human pricing
NM_001003709 Rosetta Predictions rat pricing
NM_025388 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016406 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349423 predicted 692
2 SASI_Hs01_00125037 predicted 338
3 SASI_Hs01_00125038 predicted 632
4 SASI_Hs02_00349424 predicted 493
5 SASI_Hs02_00349425 predicted 348
6 SASI_Hs01_00125042 predicted 496
7 SASI_Hs02_00349426 predicted 270
8 SASI_Hs02_00349427 predicted 865
9 SASI_Hs02_00349428 predicted 459
10 SASI_Hs02_00349429 predicted 742
11 SASI_Hs01_00125036 predicted 681
12 SASI_Hs01_00125039 predicted 678
13 SASI_Hs01_00125040 predicted 424
14 SASI_Hs01_00125041 predicted 713
15 SASI_Hs01_00125043 predicted 268
16 SASI_Hs01_00125044 predicted 777
17 SASI_Hs01_00125045 predicted 361
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003709 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113190 predicted 444
2 SASI_Rn01_00113191 predicted 276
3 SASI_Rn01_00113192 predicted 736
4 SASI_Rn01_00113193 predicted 469
5 SASI_Rn01_00113194 predicted 471
6 SASI_Rn01_00113195 predicted 316
7 SASI_Rn02_00198058 predicted 729
8 SASI_Rn01_00113196 predicted 291
9 SASI_Rn02_00198059 predicted 803
10 SASI_Rn01_00113197 predicted 738
11 SASI_Rn01_00113188 predicted 644
12 SASI_Rn01_00113189 predicted 673
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025388 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162347 predicted 367
2 SASI_Mm01_00162348 predicted 369
3 SASI_Mm01_00162349 predicted 396
4 SASI_Mm01_00162350 predicted 519
5 SASI_Mm01_00162351 predicted 206
6 SASI_Mm01_00162352 predicted 670
7 SASI_Mm01_00162353 predicted 215
8 SASI_Mm01_00162354 predicted 336
9 SASI_Mm01_00162355 predicted 716
10 SASI_Mm01_00162356 predicted 732
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016406
VALIDATED
UFC1 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-fold modifier conjugating enzyme 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004172    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_016406.x-807s1c1
Sequence:CCGGGCATCACACTTAACTCATCTACTCGAGTAGATGAGTTAAGTGTGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016406.x-712s1c1
Sequence:CCGGGTCATCCACCACAAAGAGAAACTCGAGTTTCTCTTTGTGGTGGATGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_016406.x-372s1c1
Sequence:CCGGGAACAACAAGAATGCTGACAACTCGAGTTGTCAGCATTCTTGTTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_016406.x-450s1c1
Sequence:CCGGGTATATCCATGACCTCCTGAACTCGAGTTCAGGAGGTCATGGATATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_016406.x-483s1c1
Sequence:CCGGCATCGAGTTTGACATTCCTATCTCGAGATAGGAATGTCAAACTCGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016406.3-497s21c1
Sequence:CCGGCATCGAGTTTGACATTCCTATCTCGAGATAGGAATGTCAAACTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016406.3-821s21c1
Sequence:CCGGGCATCACACTTAACTCATCTACTCGAGTAGATGAGTTAAGTGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016406.3-464s21c1
Sequence:CCGGGTATATCCATGACCTCCTGAACTCGAGTTCAGGAGGTCATGGATATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016406.3-386s21c1
Sequence:CCGGGAACAACAAGAATGCTGACAACTCGAGTTGTCAGCATTCTTGTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016406
VALIDATED
UFC1 MISSION shRNA shRNA Plasmid DNA
ubiquitin-fold modifier conjugating enzyme 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004172    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_016406.x-807s1c1
Sequence:CCGGGCATCACACTTAACTCATCTACTCGAGTAGATGAGTTAAGTGTGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016406.x-712s1c1
Sequence:CCGGGTCATCCACCACAAAGAGAAACTCGAGTTTCTCTTTGTGGTGGATGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_016406.x-372s1c1
Sequence:CCGGGAACAACAAGAATGCTGACAACTCGAGTTGTCAGCATTCTTGTTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_016406.x-450s1c1
Sequence:CCGGGTATATCCATGACCTCCTGAACTCGAGTTCAGGAGGTCATGGATATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_016406.x-483s1c1
Sequence:CCGGCATCGAGTTTGACATTCCTATCTCGAGATAGGAATGTCAAACTCGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016406.3-497s21c1
Sequence:CCGGCATCGAGTTTGACATTCCTATCTCGAGATAGGAATGTCAAACTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016406.3-821s21c1
Sequence:CCGGGCATCACACTTAACTCATCTACTCGAGTAGATGAGTTAAGTGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016406.3-464s21c1
Sequence:CCGGGTATATCCATGACCTCCTGAACTCGAGTTCAGGAGGTCATGGATATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016406.3-386s21c1
Sequence:CCGGGAACAACAAGAATGCTGACAACTCGAGTTGTCAGCATTCTTGTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016406
VALIDATED
UFC1 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-fold modifier conjugating enzyme 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004172    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_016406.x-807s1c1
Sequence:CCGGGCATCACACTTAACTCATCTACTCGAGTAGATGAGTTAAGTGTGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016406.x-712s1c1
Sequence:CCGGGTCATCCACCACAAAGAGAAACTCGAGTTTCTCTTTGTGGTGGATGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_016406.x-372s1c1
Sequence:CCGGGAACAACAAGAATGCTGACAACTCGAGTTGTCAGCATTCTTGTTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_016406.x-450s1c1
Sequence:CCGGGTATATCCATGACCTCCTGAACTCGAGTTCAGGAGGTCATGGATATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_016406.x-483s1c1
Sequence:CCGGCATCGAGTTTGACATTCCTATCTCGAGATAGGAATGTCAAACTCGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016406.3-497s21c1
Sequence:CCGGCATCGAGTTTGACATTCCTATCTCGAGATAGGAATGTCAAACTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016406.3-821s21c1
Sequence:CCGGGCATCACACTTAACTCATCTACTCGAGTAGATGAGTTAAGTGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016406.3-464s21c1
Sequence:CCGGGTATATCCATGACCTCCTGAACTCGAGTTCAGGAGGTCATGGATATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016406.3-386s21c1
Sequence:CCGGGAACAACAAGAATGCTGACAACTCGAGTTGTCAGCATTCTTGTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025388
VALIDATED
UFC1 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-fold modifier conjugating enzyme 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025388.1-369s1c1
Sequence:CCGGGAGTTCGACATCGAGTTTGAACTCGAGTTCAAACTCGATGTCGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193177    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025388.1-780s1c1
Sequence:CCGGCAAGGTCACAAAGTTTCTAAACTCGAGTTTAGAAACTTTGTGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175094    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025388.1-779s1c1
Sequence:CCGGGCAAGGTCACAAAGTTTCTAACTCGAGTTAGAAACTTTGTGACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025388.1-510s1c1
Sequence:CCGGGCCAGGAATGTGCCTAAGTTTCTCGAGAAACTTAGGCACATTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279420    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025388.2-779s21c1
Sequence:CCGGCAAGGTCACAAAGTTTCTAAACTCGAGTTTAGAAACTTTGTGACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025388.2-211s21c1
Sequence:CCGGATTGTGGGTGCAGCGACTAAACTCGAGTTTAGTCGCTGCACCCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025388.2-509s21c1
Sequence:CCGGGCCAGGAATGTGCCTAAGTTTCTCGAGAAACTTAGGCACATTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025388.2-405s21c1
Sequence:CCGGCCACTACTGCTCCGGAAATTGCTCGAGCAATTTCCGGAGCAGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025388.2-368s21c1
Sequence:CCGGGAGTTCGACATCGAGTTTGAACTCGAGTTCAAACTCGATGTCGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025388
VALIDATED
UFC1 MISSION shRNA shRNA Plasmid DNA
ubiquitin-fold modifier conjugating enzyme 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025388.1-369s1c1
Sequence:CCGGGAGTTCGACATCGAGTTTGAACTCGAGTTCAAACTCGATGTCGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193177    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025388.1-780s1c1
Sequence:CCGGCAAGGTCACAAAGTTTCTAAACTCGAGTTTAGAAACTTTGTGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175094    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025388.1-779s1c1
Sequence:CCGGGCAAGGTCACAAAGTTTCTAACTCGAGTTAGAAACTTTGTGACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025388.1-510s1c1
Sequence:CCGGGCCAGGAATGTGCCTAAGTTTCTCGAGAAACTTAGGCACATTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279420    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025388.2-779s21c1
Sequence:CCGGCAAGGTCACAAAGTTTCTAAACTCGAGTTTAGAAACTTTGTGACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025388.2-211s21c1
Sequence:CCGGATTGTGGGTGCAGCGACTAAACTCGAGTTTAGTCGCTGCACCCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025388.2-509s21c1
Sequence:CCGGGCCAGGAATGTGCCTAAGTTTCTCGAGAAACTTAGGCACATTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025388.2-405s21c1
Sequence:CCGGCCACTACTGCTCCGGAAATTGCTCGAGCAATTTCCGGAGCAGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025388.2-368s21c1
Sequence:CCGGGAGTTCGACATCGAGTTTGAACTCGAGTTCAAACTCGATGTCGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025388
VALIDATED
UFC1 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-fold modifier conjugating enzyme 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025388.1-369s1c1
Sequence:CCGGGAGTTCGACATCGAGTTTGAACTCGAGTTCAAACTCGATGTCGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193177    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025388.1-780s1c1
Sequence:CCGGCAAGGTCACAAAGTTTCTAAACTCGAGTTTAGAAACTTTGTGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175094    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025388.1-779s1c1
Sequence:CCGGGCAAGGTCACAAAGTTTCTAACTCGAGTTAGAAACTTTGTGACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025388.1-510s1c1
Sequence:CCGGGCCAGGAATGTGCCTAAGTTTCTCGAGAAACTTAGGCACATTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279420    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025388.2-779s21c1
Sequence:CCGGCAAGGTCACAAAGTTTCTAAACTCGAGTTTAGAAACTTTGTGACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025388.2-211s21c1
Sequence:CCGGATTGTGGGTGCAGCGACTAAACTCGAGTTTAGTCGCTGCACCCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025388.2-509s21c1
Sequence:CCGGGCCAGGAATGTGCCTAAGTTTCTCGAGAAACTTAGGCACATTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025388.2-405s21c1
Sequence:CCGGCCACTACTGCTCCGGAAATTGCTCGAGCAATTTCCGGAGCAGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025388.2-368s21c1
Sequence:CCGGGAGTTCGACATCGAGTTTGAACTCGAGTTCAAACTCGATGTCGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks