EMAIL THIS PAGE TO A FRIEND

UFD1L

ubiquitin fusion degradation 1 like (yeast)

Synonyms: UFD1
UniProtKB ID: Q92890, A8MW31, Q9Y5N0
Gene ID:
Human(7353) Summary: The protein encoded by this gene forms a complex with two other proteins, nuclear protein localization-4 and valosin-containing protein, and this complex is necessary for the degradation of ubiquitinated proteins. In addition, this complex controls the disassembly of the mitotic spindle and the formation of a closed nuclear envelope after mitosis. Mutations in this gene have been associated with Catch 22 syndrome as well as cardiac and craniofacial defects. Alternative splicing results in multiple transcript variants encoding different isoforms. A related pseudogene has been identified on chromosome 18. [provided by RefSeq, Jun 2009]
Mouse(22230) ubiquitin fusion degradation 1 like
Rat(84478) ubiquitin fusion degradation 1 like (yeast)
Zebrafish(436724) ubiquitin fusion degradation 1-like
chicken(374186) ubiquitin fusion degradation 1 like (yeast)
dog(608300) ubiquitin fusion degradation 1 like (yeast)
Horse(100052517) ubiquitin fusion degradation 1 like (yeast)
domestic cat(101097924) ubiquitin fusion degradation 1 like (yeast)
cow(507124) ubiquitin fusion degradation 1 like (yeast)
sheep(101121123) ubiquitin fusion degradation 1 like (yeast)
naked mole-rat(101714351) ubiquitin fusion degradation 1 like (yeast)
domestic guinea pig(100728094) ubiquitin fusion degradation 1 like (yeast)
107 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011672 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011672 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011672 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005659 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005659 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005659 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001035247 Rosetta Predictions human pricing
NM_005659 Rosetta Predictions human pricing
NM_001034834 Rosetta Predictions rat pricing
NM_053418 Rosetta Predictions rat pricing
NM_011672 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035247 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153646 predicted 985
2 SASI_Hs01_00153647 predicted 1006
3 SASI_Hs01_00153648 predicted 1177
4 SASI_Hs01_00153649 predicted 821
5 SASI_Hs02_00308174 predicted 951
6 SASI_Hs01_00153650 predicted 542
7 SASI_Hs01_00153651 predicted 761
8 SASI_Hs01_00153653 predicted 1111
9 SASI_Hs01_00153654 predicted 1125
10 SASI_Hs02_00308175 predicted 1131
11 SASI_Hs01_00153652 predicted 864
12 SASI_Hs01_00153655 predicted 928
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005659 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209616 predicted 1026
2 SASI_Hs01_00209617 predicted 1042
3 SASI_Hs01_00209618 predicted 1210
4 SASI_Hs01_00209619 predicted 857
5 SASI_Hs02_00340029 predicted 987
6 SASI_Hs01_00209620 predicted 579
7 SASI_Hs01_00209621 predicted 794
8 SASI_Hs01_00209623 predicted 1143
9 SASI_Hs01_00209624 predicted 1161
10 SASI_Hs02_00340030 predicted 1164
11 SASI_Hs01_00209622 predicted 901
12 SASI_Hs01_00209625 predicted 954
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034834 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120395 predicted 532
2 SASI_Rn01_00120396 predicted 547
3 SASI_Rn01_00120397 predicted 528
4 SASI_Rn01_00120398 predicted 602
5 SASI_Rn01_00120399 predicted 593
6 SASI_Rn01_00120400 predicted 754
7 SASI_Rn01_00120401 predicted 606
8 SASI_Rn01_00120402 predicted 603
9 SASI_Rn01_00120403 predicted 530
10 SASI_Rn01_00120404 predicted 543
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053418 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265946 predicted 1072
2 SASI_Rn02_00265947 predicted 280
3 SASI_Rn01_00118425 predicted 554
4 SASI_Rn01_00118426 predicted 860
5 SASI_Rn02_00265948 predicted 953
6 SASI_Rn01_00118427 predicted 1001
7 SASI_Rn01_00118428 predicted 562
8 SASI_Rn02_00265949 predicted 346
9 SASI_Rn01_00118429 predicted 1083
10 SASI_Rn02_00265950 predicted 305
11 SASI_Rn01_00118424 predicted 1073
12 SASI_Rn01_00118430 predicted 1104
13 SASI_Rn01_00118431 predicted 860
14 SASI_Rn01_00118432 predicted 863
15 SASI_Rn01_00118433 predicted 1103
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011672 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321188 predicted 851
2 SASI_Mm02_00321189 predicted 271
3 SASI_Mm02_00321190 predicted 479
4 SASI_Mm02_00321191 predicted 298
5 SASI_Mm02_00321192 predicted 341
6 SASI_Mm02_00321193 predicted 857
7 SASI_Mm02_00321194 predicted 332
8 SASI_Mm02_00321195 predicted 848
9 SASI_Mm02_00321196 predicted 556
10 SASI_Mm02_00321197 predicted 1068
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011672
VALIDATED
UFD1L MISSION shRNA Bacterial Glycerol Stock
ubiquitin fusion degradation 1 like (yeast)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011672.3-602s21c1
Sequence:CCGGGATGGAGACCAAACCTGACAACTCGAGTTGTCAGGTTTGGTCTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011672.3-708s21c1
Sequence:CCGGGAGGAGTCAATAGAGGGAGAACTCGAGTTCTCCCTCTATTGACTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011672.3-263s21c1
Sequence:CCGGGCTCAACATTACCTATCCTATCTCGAGATAGGATAGGTAATGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011672.3-374s21c1
Sequence:CCGGCCACTGGATGATGCAGAATTTCTCGAGAAATTCTGCATCATCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092223    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011672.2-1480s1c1
Sequence:CCGGGCCAGATATGAAAGGCAGAATCTCGAGATTCTGCCTTTCATATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011672.2-375s1c1
Sequence:CCGGCCACTGGATGATGCAGAATTTCTCGAGAAATTCTGCATCATCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011672.2-709s1c1
Sequence:CCGGGAGGAGTCAATAGAGGGAGAACTCGAGTTCTCCCTCTATTGACTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011672.2-264s1c1
Sequence:CCGGGCTCAACATTACCTATCCTATCTCGAGATAGGATAGGTAATGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011672.2-603s1c1
Sequence:CCGGGATGGAGACCAAACCTGACAACTCGAGTTGTCAGGTTTGGTCTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011672
VALIDATED
UFD1L MISSION shRNA shRNA Plasmid DNA
ubiquitin fusion degradation 1 like (yeast)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011672.3-602s21c1
Sequence:CCGGGATGGAGACCAAACCTGACAACTCGAGTTGTCAGGTTTGGTCTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011672.3-708s21c1
Sequence:CCGGGAGGAGTCAATAGAGGGAGAACTCGAGTTCTCCCTCTATTGACTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011672.3-263s21c1
Sequence:CCGGGCTCAACATTACCTATCCTATCTCGAGATAGGATAGGTAATGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011672.3-374s21c1
Sequence:CCGGCCACTGGATGATGCAGAATTTCTCGAGAAATTCTGCATCATCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092223    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011672.2-1480s1c1
Sequence:CCGGGCCAGATATGAAAGGCAGAATCTCGAGATTCTGCCTTTCATATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011672.2-375s1c1
Sequence:CCGGCCACTGGATGATGCAGAATTTCTCGAGAAATTCTGCATCATCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011672.2-709s1c1
Sequence:CCGGGAGGAGTCAATAGAGGGAGAACTCGAGTTCTCCCTCTATTGACTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011672.2-264s1c1
Sequence:CCGGGCTCAACATTACCTATCCTATCTCGAGATAGGATAGGTAATGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011672.2-603s1c1
Sequence:CCGGGATGGAGACCAAACCTGACAACTCGAGTTGTCAGGTTTGGTCTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011672
VALIDATED
UFD1L MISSION shRNA Lentiviral Transduction Particles
ubiquitin fusion degradation 1 like (yeast)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011672.3-602s21c1
Sequence:CCGGGATGGAGACCAAACCTGACAACTCGAGTTGTCAGGTTTGGTCTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011672.3-708s21c1
Sequence:CCGGGAGGAGTCAATAGAGGGAGAACTCGAGTTCTCCCTCTATTGACTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011672.3-263s21c1
Sequence:CCGGGCTCAACATTACCTATCCTATCTCGAGATAGGATAGGTAATGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011672.3-374s21c1
Sequence:CCGGCCACTGGATGATGCAGAATTTCTCGAGAAATTCTGCATCATCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092223    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011672.2-1480s1c1
Sequence:CCGGGCCAGATATGAAAGGCAGAATCTCGAGATTCTGCCTTTCATATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011672.2-375s1c1
Sequence:CCGGCCACTGGATGATGCAGAATTTCTCGAGAAATTCTGCATCATCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011672.2-709s1c1
Sequence:CCGGGAGGAGTCAATAGAGGGAGAACTCGAGTTCTCCCTCTATTGACTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011672.2-264s1c1
Sequence:CCGGGCTCAACATTACCTATCCTATCTCGAGATAGGATAGGTAATGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011672.2-603s1c1
Sequence:CCGGGATGGAGACCAAACCTGACAACTCGAGTTGTCAGGTTTGGTCTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005659
VALIDATED
UFD1L MISSION shRNA Bacterial Glycerol Stock
ubiquitin fusion degradation 1 like (yeast)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000279739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_005659.5-810s21c1
Sequence:CCGGCTGGCAATAGACTGGATGGAACTCGAGTTCCATCCAGTCTATTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005659.5-702s21c1
Sequence:CCGGTGGGCTACAAAGAACCCGAAACTCGAGTTTCGGGTTCTTTGTAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005659.5-859s21c1
Sequence:CCGGCCCAATCAAGCCTGGAGATATCTCGAGATATCTCCAGGCTTGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005659.5-313s21c1
Sequence:CCGGGCTGTTCAAACTGACCAATAACTCGAGTTATTGGTCAGTTTGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005659.3-272s1c1
Sequence:CCGGGCTGTTCAAACTGACCAATAACTCGAGTTATTGGTCAGTTTGAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005659.3-769s1c1
Sequence:CCGGCTGGCAATAGACTGGATGGAACTCGAGTTCCATCCAGTCTATTGCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005659.3-245s1c1
Sequence:CCGGCAGCCGACTTAACATTACCTACTCGAGTAGGTAATGTTAAGTCGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005659.3-818s1c1
Sequence:CCGGCCCAATCAAGCCTGGAGATATCTCGAGATATCTCCAGGCTTGATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005659.3-661s1c1
Sequence:CCGGTGGGCTACAAAGAACCCGAAACTCGAGTTTCGGGTTCTTTGTAGCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005659
VALIDATED
UFD1L MISSION shRNA shRNA Plasmid DNA
ubiquitin fusion degradation 1 like (yeast)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000279739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_005659.5-810s21c1
Sequence:CCGGCTGGCAATAGACTGGATGGAACTCGAGTTCCATCCAGTCTATTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005659.5-702s21c1
Sequence:CCGGTGGGCTACAAAGAACCCGAAACTCGAGTTTCGGGTTCTTTGTAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005659.5-859s21c1
Sequence:CCGGCCCAATCAAGCCTGGAGATATCTCGAGATATCTCCAGGCTTGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005659.5-313s21c1
Sequence:CCGGGCTGTTCAAACTGACCAATAACTCGAGTTATTGGTCAGTTTGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005659.3-272s1c1
Sequence:CCGGGCTGTTCAAACTGACCAATAACTCGAGTTATTGGTCAGTTTGAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005659.3-769s1c1
Sequence:CCGGCTGGCAATAGACTGGATGGAACTCGAGTTCCATCCAGTCTATTGCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005659.3-245s1c1
Sequence:CCGGCAGCCGACTTAACATTACCTACTCGAGTAGGTAATGTTAAGTCGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005659.3-818s1c1
Sequence:CCGGCCCAATCAAGCCTGGAGATATCTCGAGATATCTCCAGGCTTGATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005659.3-661s1c1
Sequence:CCGGTGGGCTACAAAGAACCCGAAACTCGAGTTTCGGGTTCTTTGTAGCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005659
VALIDATED
UFD1L MISSION shRNA Lentiviral Transduction Particles
ubiquitin fusion degradation 1 like (yeast)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000279739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_005659.5-810s21c1
Sequence:CCGGCTGGCAATAGACTGGATGGAACTCGAGTTCCATCCAGTCTATTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005659.5-702s21c1
Sequence:CCGGTGGGCTACAAAGAACCCGAAACTCGAGTTTCGGGTTCTTTGTAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005659.5-859s21c1
Sequence:CCGGCCCAATCAAGCCTGGAGATATCTCGAGATATCTCCAGGCTTGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005659.5-313s21c1
Sequence:CCGGGCTGTTCAAACTGACCAATAACTCGAGTTATTGGTCAGTTTGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005659.3-272s1c1
Sequence:CCGGGCTGTTCAAACTGACCAATAACTCGAGTTATTGGTCAGTTTGAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005659.3-769s1c1
Sequence:CCGGCTGGCAATAGACTGGATGGAACTCGAGTTCCATCCAGTCTATTGCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005659.3-245s1c1
Sequence:CCGGCAGCCGACTTAACATTACCTACTCGAGTAGGTAATGTTAAGTCGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005659.3-818s1c1
Sequence:CCGGCCCAATCAAGCCTGGAGATATCTCGAGATATCTCCAGGCTTGATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005659.3-661s1c1
Sequence:CCGGTGGGCTACAAAGAACCCGAAACTCGAGTTTCGGGTTCTTTGTAGCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks