EMAIL THIS PAGE TO A FRIEND

UFL1

UFM1-specific ligase 1

Synonyms: KIAA0776 Maxer NLBP RCAD RP3-393D12.1
UniProtKB ID: O94874, A0PJ53, B4DJ57, C0H5X5, Q8N765, Q9NTQ0
Gene ID:
Mouse(67490) UFM1 specific ligase 1
Rat(313115) Ufm1-specific ligase 1
domestic guinea pig(100734148) UFM1-specific ligase 1
naked mole-rat(101721913) UFM1-specific ligase 1
cow(515894) UFM1-specific ligase 1
sheep(101106268) UFM1-specific ligase 1
Zebrafish(393578) UFM1-specific ligase 1
chicken(421804) UFM1-specific ligase 1
dog(474999) UFM1-specific ligase 1
domestic cat(101080636) UFM1-specific ligase 1
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015323 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015323 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015323 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026194 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026194 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026194 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015323 Rosetta Predictions human pricing
NM_001126279 Rosetta Predictions rat pricing
NM_026194 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015323 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347600 predicted 2278
2 SASI_Hs02_00347601 predicted 501
3 SASI_Hs01_00229880 predicted 1635
4 SASI_Hs01_00229881 predicted 2270
5 SASI_Hs01_00229882 predicted 2216
6 SASI_Hs01_00229884 predicted 2364
7 SASI_Hs01_00229885 predicted 544
8 SASI_Hs01_00229886 predicted 1649
9 SASI_Hs01_00229887 predicted 441
10 SASI_Hs02_00347602 predicted 1225
11 SASI_Hs01_00229878 predicted 792
12 SASI_Hs01_00229879 predicted 539
13 SASI_Hs01_00229883 predicted 1757
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126279 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253163 predicted 409
2 SASI_Rn02_00253164 predicted 799
3 SASI_Rn02_00253165 predicted 358
4 SASI_Rn02_00253166 predicted 849
5 SASI_Rn02_00253167 predicted 267
6 SASI_Rn02_00253168 predicted 1482
7 SASI_Rn02_00253169 predicted 2457
8 SASI_Rn02_00253170 predicted 391
9 SASI_Rn02_00253171 predicted 507
10 SASI_Rn02_00253172 predicted 1241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026194 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088677 predicted 1071
2 SASI_Mm01_00088678 predicted 1612
3 SASI_Mm01_00088679 predicted 2337
4 SASI_Mm01_00088680 predicted 1558
5 SASI_Mm01_00088681 predicted 2286
6 SASI_Mm01_00088682 predicted 287
7 SASI_Mm01_00088684 predicted 575
8 SASI_Mm01_00088685 predicted 472
9 SASI_Mm02_00329858 predicted 418
10 SASI_Mm02_00329859 predicted 1233
11 SASI_Mm01_00088683 predicted 1525
12 SASI_Mm01_00088686 predicted 804
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015323
UFL1 MISSION shRNA Bacterial Glycerol Stock
UFM1-specific ligase 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145385    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015323.2-3102s1c1
Sequence:CCGGGAGAGAGAACACATGCAATTTCTCGAGAAATTGCATGTGTTCTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144289    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015323.2-3193s1c1
Sequence:CCGGCCCAGTTTGCATTTGTACATTCTCGAGAATGTACAAATGCAAACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015323.2-2338s1c1
Sequence:CCGGCGTAAAGAGCTTCAAGAACTTCTCGAGAAGTTCTTGAAGCTCTTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015323.2-1247s1c1
Sequence:CCGGCCACTTTAGAAAGCGTTAGTACTCGAGTACTAACGCTTTCTAAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144935    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015323.2-3303s1c1
Sequence:CCGGGAGCATCTGTAAGTGCATTTACTCGAGTAAATGCACTTACAGATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145030    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015323.2-2861s1c1
Sequence:CCGGGAAACACTTCTGTGTCAGAAACTCGAGTTTCTGACACAGAAGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015323.2-986s1c1
Sequence:CCGGGCTCTGGAACATGGGTTGATACTCGAGTATCAACCCATGTTCCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122062    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015323.2-3127s1c1
Sequence:CCGGCCAGTAAGCATAAGTCATATTCTCGAGAATATGACTTATGCTTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015323.2-1207s1c1
Sequence:CCGGCCTGTGCATTTAATCACTGAACTCGAGTTCAGTGATTAAATGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015323.2-2274s1c1
Sequence:CCGGGCAGGGAGATTATCCCTTGAACTCGAGTTCAAGGGATAATCTCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142805    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015323.2-2524s1c1
Sequence:CCGGCCACCTCATACACACACAATTCTCGAGAATTGTGTGTGTATGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015323.2-196s1c1
Sequence:CCGGGAATACATTACTCCAGCCCAACTCGAGTTGGGCTGGAGTAATGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015323
UFL1 MISSION shRNA shRNA Plasmid DNA
UFM1-specific ligase 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145385    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015323.2-3102s1c1
Sequence:CCGGGAGAGAGAACACATGCAATTTCTCGAGAAATTGCATGTGTTCTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144289    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015323.2-3193s1c1
Sequence:CCGGCCCAGTTTGCATTTGTACATTCTCGAGAATGTACAAATGCAAACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015323.2-2338s1c1
Sequence:CCGGCGTAAAGAGCTTCAAGAACTTCTCGAGAAGTTCTTGAAGCTCTTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015323.2-1247s1c1
Sequence:CCGGCCACTTTAGAAAGCGTTAGTACTCGAGTACTAACGCTTTCTAAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144935    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015323.2-3303s1c1
Sequence:CCGGGAGCATCTGTAAGTGCATTTACTCGAGTAAATGCACTTACAGATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145030    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015323.2-2861s1c1
Sequence:CCGGGAAACACTTCTGTGTCAGAAACTCGAGTTTCTGACACAGAAGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015323.2-986s1c1
Sequence:CCGGGCTCTGGAACATGGGTTGATACTCGAGTATCAACCCATGTTCCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122062    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015323.2-3127s1c1
Sequence:CCGGCCAGTAAGCATAAGTCATATTCTCGAGAATATGACTTATGCTTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015323.2-1207s1c1
Sequence:CCGGCCTGTGCATTTAATCACTGAACTCGAGTTCAGTGATTAAATGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015323.2-2274s1c1
Sequence:CCGGGCAGGGAGATTATCCCTTGAACTCGAGTTCAAGGGATAATCTCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142805    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015323.2-2524s1c1
Sequence:CCGGCCACCTCATACACACACAATTCTCGAGAATTGTGTGTGTATGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015323.2-196s1c1
Sequence:CCGGGAATACATTACTCCAGCCCAACTCGAGTTGGGCTGGAGTAATGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015323
UFL1 MISSION shRNA Lentiviral Transduction Particles
UFM1-specific ligase 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145385    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015323.2-3102s1c1
Sequence:CCGGGAGAGAGAACACATGCAATTTCTCGAGAAATTGCATGTGTTCTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144289    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015323.2-3193s1c1
Sequence:CCGGCCCAGTTTGCATTTGTACATTCTCGAGAATGTACAAATGCAAACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015323.2-2338s1c1
Sequence:CCGGCGTAAAGAGCTTCAAGAACTTCTCGAGAAGTTCTTGAAGCTCTTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015323.2-1247s1c1
Sequence:CCGGCCACTTTAGAAAGCGTTAGTACTCGAGTACTAACGCTTTCTAAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144935    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015323.2-3303s1c1
Sequence:CCGGGAGCATCTGTAAGTGCATTTACTCGAGTAAATGCACTTACAGATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145030    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015323.2-2861s1c1
Sequence:CCGGGAAACACTTCTGTGTCAGAAACTCGAGTTTCTGACACAGAAGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015323.2-986s1c1
Sequence:CCGGGCTCTGGAACATGGGTTGATACTCGAGTATCAACCCATGTTCCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122062    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015323.2-3127s1c1
Sequence:CCGGCCAGTAAGCATAAGTCATATTCTCGAGAATATGACTTATGCTTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015323.2-1207s1c1
Sequence:CCGGCCTGTGCATTTAATCACTGAACTCGAGTTCAGTGATTAAATGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015323.2-2274s1c1
Sequence:CCGGGCAGGGAGATTATCCCTTGAACTCGAGTTCAAGGGATAATCTCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142805    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015323.2-2524s1c1
Sequence:CCGGCCACCTCATACACACACAATTCTCGAGAATTGTGTGTGTATGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015323.2-196s1c1
Sequence:CCGGGAATACATTACTCCAGCCCAACTCGAGTTGGGCTGGAGTAATGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026194
VALIDATED
UFL1 MISSION shRNA Bacterial Glycerol Stock
UFM1-specific ligase 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201728    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026194.2-2533s1c1
Sequence:CCGGGCAGACTTTATGGGAAGCTTTCTCGAGAAAGCTTCCCATAAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026194.2-240s1c1
Sequence:CCGGCGAGTAAACATTGTTGACTTACTCGAGTAAGTCAACAATGTTTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026194.3-1068s21c1
Sequence:CCGGTCGCTTCAGCTATAGTCTTTACTCGAGTAAAGACTATAGCTGAAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026194.3-2330s1c1
Sequence:CCGGGAACTGTCATTATCCATTAAGCTCGAGCTTAATGGATAATGACAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026194.3-487s21c1
Sequence:CCGGTCAGCGACTTGGCCGGATTATCTCGAGATAATCCGGCCAAGTCGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264453    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026194.3-2522s21c1
Sequence:CCGGGGTAATAGATGCAGACTTTATCTCGAGATAAAGTCTGCATCTATTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026194.3-253s21c1
Sequence:CCGGTGACTTACAACAGGTTATTAACTCGAGTTAATAACCTGTTGTAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026194.3-295s1c1
Sequence:CCGGGAGTAGAGTCAGTGATATTATCTCGAGATAATATCACTGACTCTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026194.3-226s21c1
Sequence:CCGGTGTCCGAGGTGGTCGAGTAAACTCGAGTTTACTCGACCACCTCGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026194
VALIDATED
UFL1 MISSION shRNA shRNA Plasmid DNA
UFM1-specific ligase 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201728    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026194.2-2533s1c1
Sequence:CCGGGCAGACTTTATGGGAAGCTTTCTCGAGAAAGCTTCCCATAAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026194.2-240s1c1
Sequence:CCGGCGAGTAAACATTGTTGACTTACTCGAGTAAGTCAACAATGTTTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026194.3-1068s21c1
Sequence:CCGGTCGCTTCAGCTATAGTCTTTACTCGAGTAAAGACTATAGCTGAAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026194.3-2330s1c1
Sequence:CCGGGAACTGTCATTATCCATTAAGCTCGAGCTTAATGGATAATGACAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026194.3-487s21c1
Sequence:CCGGTCAGCGACTTGGCCGGATTATCTCGAGATAATCCGGCCAAGTCGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264453    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026194.3-2522s21c1
Sequence:CCGGGGTAATAGATGCAGACTTTATCTCGAGATAAAGTCTGCATCTATTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026194.3-253s21c1
Sequence:CCGGTGACTTACAACAGGTTATTAACTCGAGTTAATAACCTGTTGTAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026194.3-295s1c1
Sequence:CCGGGAGTAGAGTCAGTGATATTATCTCGAGATAATATCACTGACTCTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026194.3-226s21c1
Sequence:CCGGTGTCCGAGGTGGTCGAGTAAACTCGAGTTTACTCGACCACCTCGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026194
VALIDATED
UFL1 MISSION shRNA Lentiviral Transduction Particles
UFM1-specific ligase 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201728    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026194.2-2533s1c1
Sequence:CCGGGCAGACTTTATGGGAAGCTTTCTCGAGAAAGCTTCCCATAAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026194.2-240s1c1
Sequence:CCGGCGAGTAAACATTGTTGACTTACTCGAGTAAGTCAACAATGTTTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026194.3-1068s21c1
Sequence:CCGGTCGCTTCAGCTATAGTCTTTACTCGAGTAAAGACTATAGCTGAAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026194.3-2330s1c1
Sequence:CCGGGAACTGTCATTATCCATTAAGCTCGAGCTTAATGGATAATGACAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026194.3-487s21c1
Sequence:CCGGTCAGCGACTTGGCCGGATTATCTCGAGATAATCCGGCCAAGTCGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264453    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026194.3-2522s21c1
Sequence:CCGGGGTAATAGATGCAGACTTTATCTCGAGATAAAGTCTGCATCTATTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026194.3-253s21c1
Sequence:CCGGTGACTTACAACAGGTTATTAACTCGAGTTAATAACCTGTTGTAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026194.3-295s1c1
Sequence:CCGGGAGTAGAGTCAGTGATATTATCTCGAGATAATATCACTGACTCTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026194.3-226s21c1
Sequence:CCGGTGTCCGAGGTGGTCGAGTAAACTCGAGTTTACTCGACCACCTCGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks