EMAIL THIS PAGE TO A FRIEND

UFM1

ubiquitin-fold modifier 1

Synonyms: BM-002 C13orf20 bA131P10.1
UniProtKB ID: P61960, Q14346, Q5VXS0, Q6IAG6, Q9CPX2, Q9NZF2
Gene ID:
Human(51569) Summary: UFM1 is a ubiquitin-like protein that is conjugated to target proteins by E1-like activating enzyme UBA5 (UBE1DC1; MIM 610552) and E2-like conjugating enzyme UFC1 (MIM 610554) in a manner analogous to ubiquitylation (see UBE2M; MIM 603173) (Komatsu et al., 2004 [PubMed 15071506]
Mouse(67890) ubiquitin-fold modifier 1
Rat(365797) ubiquitin-fold modifier 1
Zebrafish(322756) ubiquitin-fold modifier 1
chicken(418894) ubiquitin-fold modifier 1
dog(477297) ubiquitin-fold modifier 1
cow(530547) ubiquitin-fold modifier 1
sheep(101102155) ubiquitin-fold modifier 1
naked mole-rat(101712999) ubiquitin-fold modifier 1
domestic guinea pig(101788383) ubiquitin-fold modifier 1
96 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026435 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026435 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026435 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016617 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016617 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016617 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016617 Rosetta Predictions human pricing
NM_001126080 Rosetta Predictions rat pricing
NM_026435 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016617 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054432 predicted 364
2 SASI_Hs01_00054433 predicted 248
3 SASI_Hs01_00054434 predicted 294
4 SASI_Hs01_00054435 predicted 633
5 SASI_Hs01_00054436 predicted 523
6 SASI_Hs01_00054437 predicted 508
7 SASI_Hs02_00349769 predicted 82
8 SASI_Hs01_00054438 predicted 691
9 SASI_Hs01_00054439 predicted 768
10 SASI_Hs01_00054440 predicted 304
11 SASI_Hs01_00054441 predicted 757
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126080 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252813 predicted 255
2 SASI_Rn02_00252814 predicted 502
3 SASI_Rn02_00252815 predicted 675
4 SASI_Rn02_00252816 predicted 555
5 SASI_Rn02_00252817 predicted 709
6 SASI_Rn02_00252818 predicted 720
7 SASI_Rn02_00252819 predicted 270
8 SASI_Rn02_00252820 predicted 681
9 SASI_Rn02_00252821 predicted 512
10 SASI_Rn02_00252822 predicted 342
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026435 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191954 predicted 200
2 SASI_Mm02_00330262 predicted 710
3 SASI_Mm01_00191955 predicted 387
4 SASI_Mm01_00191957 predicted 749
5 SASI_Mm02_00330263 predicted 556
6 SASI_Mm01_00191958 predicted 751
7 SASI_Mm01_00191959 predicted 266
8 SASI_Mm01_00191960 predicted 202
9 SASI_Mm01_00191952 predicted 306
10 SASI_Mm01_00191953 predicted 697
11 SASI_Mm01_00191956 predicted 733
12 SASI_Mm01_00191961 predicted 743
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026435
VALIDATED
UFM1 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-fold modifier 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026435.4-815s21c1
Sequence:CCGGTTATAGGATCTAACCATTATGCTCGAGCATAATGGTTAGATCCTATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026435.4-300s21c1
Sequence:CCGGAGTTGGAAGCTGCTAATATATCTCGAGATATATTAGCAGCTTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026435.4-137s21c1
Sequence:CCGGCGCCGTTCACAGCAGTGCTAACTCGAGTTAGCACTGCTGTGAACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026435.4-187s21c1
Sequence:CCGGGCAGCTACAAGTGCGATTATTCTCGAGAATAATCGCACTTGTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026435.4-267s21c1
Sequence:CCGGCGGCTCAGAACTGAGAATCATCTCGAGATGATTCTCAGTTCTGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125719    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026435.2-1007s1c1
Sequence:CCGGGCAGAGATGATCTGAAGCATTCTCGAGAATGCTTCAGATCATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026435.2-233s1c1
Sequence:CCGGCGGCTCAGAACTGAGAATCATCTCGAGATGATTCTCAGTTCTGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026435.2-153s1c1
Sequence:CCGGGCAGCTACAAGTGCGATTATTCTCGAGAATAATCGCACTTGTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026435.2-103s1c1
Sequence:CCGGCGCCGTTCACAGCAGTGCTAACTCGAGTTAGCACTGCTGTGAACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026435.2-71s1c1
Sequence:CCGGGCCGTACAAAGTTCTCAGTGTCTCGAGACACTGAGAACTTTGTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026435
VALIDATED
UFM1 MISSION shRNA shRNA Plasmid DNA
ubiquitin-fold modifier 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026435.4-815s21c1
Sequence:CCGGTTATAGGATCTAACCATTATGCTCGAGCATAATGGTTAGATCCTATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026435.4-300s21c1
Sequence:CCGGAGTTGGAAGCTGCTAATATATCTCGAGATATATTAGCAGCTTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026435.4-137s21c1
Sequence:CCGGCGCCGTTCACAGCAGTGCTAACTCGAGTTAGCACTGCTGTGAACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026435.4-187s21c1
Sequence:CCGGGCAGCTACAAGTGCGATTATTCTCGAGAATAATCGCACTTGTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026435.4-267s21c1
Sequence:CCGGCGGCTCAGAACTGAGAATCATCTCGAGATGATTCTCAGTTCTGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125719    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026435.2-1007s1c1
Sequence:CCGGGCAGAGATGATCTGAAGCATTCTCGAGAATGCTTCAGATCATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026435.2-233s1c1
Sequence:CCGGCGGCTCAGAACTGAGAATCATCTCGAGATGATTCTCAGTTCTGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026435.2-153s1c1
Sequence:CCGGGCAGCTACAAGTGCGATTATTCTCGAGAATAATCGCACTTGTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026435.2-103s1c1
Sequence:CCGGCGCCGTTCACAGCAGTGCTAACTCGAGTTAGCACTGCTGTGAACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026435.2-71s1c1
Sequence:CCGGGCCGTACAAAGTTCTCAGTGTCTCGAGACACTGAGAACTTTGTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026435
VALIDATED
UFM1 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-fold modifier 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026435.4-815s21c1
Sequence:CCGGTTATAGGATCTAACCATTATGCTCGAGCATAATGGTTAGATCCTATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026435.4-300s21c1
Sequence:CCGGAGTTGGAAGCTGCTAATATATCTCGAGATATATTAGCAGCTTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026435.4-137s21c1
Sequence:CCGGCGCCGTTCACAGCAGTGCTAACTCGAGTTAGCACTGCTGTGAACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026435.4-187s21c1
Sequence:CCGGGCAGCTACAAGTGCGATTATTCTCGAGAATAATCGCACTTGTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026435.4-267s21c1
Sequence:CCGGCGGCTCAGAACTGAGAATCATCTCGAGATGATTCTCAGTTCTGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125719    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026435.2-1007s1c1
Sequence:CCGGGCAGAGATGATCTGAAGCATTCTCGAGAATGCTTCAGATCATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026435.2-233s1c1
Sequence:CCGGCGGCTCAGAACTGAGAATCATCTCGAGATGATTCTCAGTTCTGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026435.2-153s1c1
Sequence:CCGGGCAGCTACAAGTGCGATTATTCTCGAGAATAATCGCACTTGTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026435.2-103s1c1
Sequence:CCGGCGCCGTTCACAGCAGTGCTAACTCGAGTTAGCACTGCTGTGAACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026435.2-71s1c1
Sequence:CCGGGCCGTACAAAGTTCTCAGTGTCTCGAGACACTGAGAACTTTGTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016617
UFM1 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-fold modifier 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016617.1-281s21c1
Sequence:CCGGGTGTTGGAAGTTGTTAATATCCTCGAGGATATTAACAACTTCCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016617.1-249s21c1
Sequence:CCGGTGGTTCAGAACTGCGGATTATCTCGAGATAATCCGCAGTTCTGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016617.1-192s21c1
Sequence:CCGGCAATGATGGAATAGGAATAAACTCGAGTTTATTCCTATTCCATCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016617.1-119s21c1
Sequence:CCGGCACCTTTCACAGCAGTCTTAACTCGAGTTAAGACTGCTGTGAAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257386    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016617.1-1585s21c1
Sequence:CCGGACGAAATCAAAGCCCATTAATCTCGAGATTAATGGGCTTTGATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016617.1-191s1c1
Sequence:CCGGCCAATGATGGAATAGGAATAACTCGAGTTATTCCTATTCCATCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016617.1-166s1c1
Sequence:CCGGCCTGCTGCAACAAGTGCAATTCTCGAGAATTGCACTTGTTGCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016617.1-130s1c1
Sequence:CCGGGCAGTCTTAAAGTTTGCAGCACTCGAGTGCTGCAAACTTTAAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016617.1-104s1c1
Sequence:CCGGGTGTTCCTGAAAGTACACCTTCTCGAGAAGGTGTACTTTCAGGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016617.1-259s1c1
Sequence:CCGGCTGCGGATTATTCCTAGAGATCTCGAGATCTCTAGGAATAATCCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016617
UFM1 MISSION shRNA shRNA Plasmid DNA
ubiquitin-fold modifier 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016617.1-281s21c1
Sequence:CCGGGTGTTGGAAGTTGTTAATATCCTCGAGGATATTAACAACTTCCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016617.1-249s21c1
Sequence:CCGGTGGTTCAGAACTGCGGATTATCTCGAGATAATCCGCAGTTCTGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016617.1-192s21c1
Sequence:CCGGCAATGATGGAATAGGAATAAACTCGAGTTTATTCCTATTCCATCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016617.1-119s21c1
Sequence:CCGGCACCTTTCACAGCAGTCTTAACTCGAGTTAAGACTGCTGTGAAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257386    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016617.1-1585s21c1
Sequence:CCGGACGAAATCAAAGCCCATTAATCTCGAGATTAATGGGCTTTGATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016617.1-191s1c1
Sequence:CCGGCCAATGATGGAATAGGAATAACTCGAGTTATTCCTATTCCATCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016617.1-166s1c1
Sequence:CCGGCCTGCTGCAACAAGTGCAATTCTCGAGAATTGCACTTGTTGCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016617.1-130s1c1
Sequence:CCGGGCAGTCTTAAAGTTTGCAGCACTCGAGTGCTGCAAACTTTAAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016617.1-104s1c1
Sequence:CCGGGTGTTCCTGAAAGTACACCTTCTCGAGAAGGTGTACTTTCAGGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016617.1-259s1c1
Sequence:CCGGCTGCGGATTATTCCTAGAGATCTCGAGATCTCTAGGAATAATCCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016617
UFM1 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-fold modifier 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016617.1-281s21c1
Sequence:CCGGGTGTTGGAAGTTGTTAATATCCTCGAGGATATTAACAACTTCCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016617.1-249s21c1
Sequence:CCGGTGGTTCAGAACTGCGGATTATCTCGAGATAATCCGCAGTTCTGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016617.1-192s21c1
Sequence:CCGGCAATGATGGAATAGGAATAAACTCGAGTTTATTCCTATTCCATCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016617.1-119s21c1
Sequence:CCGGCACCTTTCACAGCAGTCTTAACTCGAGTTAAGACTGCTGTGAAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257386    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016617.1-1585s21c1
Sequence:CCGGACGAAATCAAAGCCCATTAATCTCGAGATTAATGGGCTTTGATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016617.1-191s1c1
Sequence:CCGGCCAATGATGGAATAGGAATAACTCGAGTTATTCCTATTCCATCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016617.1-166s1c1
Sequence:CCGGCCTGCTGCAACAAGTGCAATTCTCGAGAATTGCACTTGTTGCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016617.1-130s1c1
Sequence:CCGGGCAGTCTTAAAGTTTGCAGCACTCGAGTGCTGCAAACTTTAAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016617.1-104s1c1
Sequence:CCGGGTGTTCCTGAAAGTACACCTTCTCGAGAAGGTGTACTTTCAGGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016617.1-259s1c1
Sequence:CCGGCTGCGGATTATTCCTAGAGATCTCGAGATCTCTAGGAATAATCCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks