EMAIL THIS PAGE TO A FRIEND

UFSP1

UFM1-specific peptidase 1 (non-functional)

Synonyms: UFSP
UniProtKB ID: Q6NVU6, A4D2E4, A8K8V2, B6ZDG6, Q9BXP6
Gene ID:
Human(402682) Summary: This gene encodes a protein that is similar to other Ufm1-specific proteases. Studies in mouse determined that Ufsp1 releases Ufm1 (ubiquitin-fold modifier 1) from its bound conjugated complexes which also makes it into an active form. Because the human UFSP1 protein is shorter on the N-terminus and lacks a conserved Cys active site, it is predicted to be non-functional.[provided by RefSeq, Nov 2009]
Mouse(70240) UFM1-specific peptidase 1
dog(608352) UFM1-specific peptidase 1 (non-functional)
cow(527939) UFM1-specific peptidase 1 (non-functional)
34 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_380026 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_380026 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_380026 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027356 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027356 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027356 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU005991 MISSION® esiRNA esiRNA targeting mouse Ufsp1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001015072 Rosetta Predictions human pricing
NM_027356 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015072 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095438 predicted 689
2 SASI_Hs01_00095439 predicted 689
3 SASI_Hs01_00095440 predicted 503
4 SASI_Hs01_00095442 predicted 680
5 SASI_Hs02_00306659 predicted 665
6 SASI_Hs02_00306660 predicted 649
7 SASI_Hs01_00095444 predicted 472
8 SASI_Hs02_00306661 predicted 668
9 SASI_Hs01_00095445 predicted 584
10 SASI_Hs01_00095446 predicted 705
11 SASI_Hs01_00095441 predicted 472
12 SASI_Hs01_00095443 predicted 631
13 SASI_Hs01_00095447 predicted 472
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027356 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178895 predicted 716
2 SASI_Mm01_00178896 predicted 207
3 SASI_Mm01_00178898 predicted 511
4 SASI_Mm02_00332030 predicted 683
5 SASI_Mm01_00178899 predicted 548
6 SASI_Mm01_00178900 predicted 613
7 SASI_Mm01_00178901 predicted 215
8 SASI_Mm01_00178902 predicted 226
9 SASI_Mm01_00178903 predicted 501
10 SASI_Mm01_00178904 predicted 222
11 SASI_Mm01_00178897 predicted 428
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_380026
UFSP1 MISSION shRNA Bacterial Glycerol Stock
UFM1-specific peptidase 1 (non-functional)
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000203921    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_380026.1-52s1c1
Sequence:CCGGCCAATAAACTGTTACAGCCACCTCGAGGTGGCTGTAACAGTTTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_380026.1-48s1c1
Sequence:CCGGGCTGCCAATAAACTGTTACAGCTCGAGCTGTAACAGTTTATTGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_380026.1-601s1c1
Sequence:CCGGGAAGCCTATGTCCTGGTATTGCTCGAGCAATACCAGGACATAGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204312    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_380026.1-201s1c1
Sequence:CCGGCCACTACCTCTACTACCACTACTCGAGTAGTGGTAGTAGAGGTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_380026
UFSP1 MISSION shRNA shRNA Plasmid DNA
UFM1-specific peptidase 1 (non-functional)
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000203921    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_380026.1-52s1c1
Sequence:CCGGCCAATAAACTGTTACAGCCACCTCGAGGTGGCTGTAACAGTTTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_380026.1-48s1c1
Sequence:CCGGGCTGCCAATAAACTGTTACAGCTCGAGCTGTAACAGTTTATTGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_380026.1-601s1c1
Sequence:CCGGGAAGCCTATGTCCTGGTATTGCTCGAGCAATACCAGGACATAGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204312    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_380026.1-201s1c1
Sequence:CCGGCCACTACCTCTACTACCACTACTCGAGTAGTGGTAGTAGAGGTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_380026
UFSP1 MISSION shRNA Lentiviral Transduction Particles
UFM1-specific peptidase 1 (non-functional)
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000203921    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_380026.1-52s1c1
Sequence:CCGGCCAATAAACTGTTACAGCCACCTCGAGGTGGCTGTAACAGTTTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_380026.1-48s1c1
Sequence:CCGGGCTGCCAATAAACTGTTACAGCTCGAGCTGTAACAGTTTATTGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_380026.1-601s1c1
Sequence:CCGGGAAGCCTATGTCCTGGTATTGCTCGAGCAATACCAGGACATAGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204312    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_380026.1-201s1c1
Sequence:CCGGCCACTACCTCTACTACCACTACTCGAGTAGTGGTAGTAGAGGTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027356
UFSP1 MISSION shRNA Bacterial Glycerol Stock
UFM1-specific peptidase 1 (non-functional)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201692    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027356.1-821s1c1
Sequence:CCGGGACTAAACACAGCCACCTATTCTCGAGAATAGGTGGCTGTGTTTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190103    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027356.1-819s1c1
Sequence:CCGGGAGACTAAACACAGCCACCTACTCGAGTAGGTGGCTGTGTTTAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027356.2-612s21c1
Sequence:CCGGGGCCAGGTTCAGAAGTCTATGCTCGAGCATAGACTTCTGAACCTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027356.2-225s21c1
Sequence:CCGGACTACCTTTACTATCACTATGCTCGAGCATAGTGATAGTAAAGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027356.2-731s1c1
Sequence:CCGGGATTCCAATTCCTTCTACAACCTCGAGGTTGTAGAAGGAATTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027356.2-750s21c1
Sequence:CCGGACTTGTGCTTCACCAGAAATCCTCGAGGATTTCTGGTGAAGCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248559    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027356.2-822s21c1
Sequence:CCGGCTAAACACAGCCACCTATTTACTCGAGTAAATAGGTGGCTGTGTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027356.2-506s21c1
Sequence:CCGGGGAGAAGAGGAGCGGCTTTATCTCGAGATAAAGCCGCTCCTCTTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027356
UFSP1 MISSION shRNA shRNA Plasmid DNA
UFM1-specific peptidase 1 (non-functional)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201692    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027356.1-821s1c1
Sequence:CCGGGACTAAACACAGCCACCTATTCTCGAGAATAGGTGGCTGTGTTTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190103    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027356.1-819s1c1
Sequence:CCGGGAGACTAAACACAGCCACCTACTCGAGTAGGTGGCTGTGTTTAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027356.2-612s21c1
Sequence:CCGGGGCCAGGTTCAGAAGTCTATGCTCGAGCATAGACTTCTGAACCTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027356.2-225s21c1
Sequence:CCGGACTACCTTTACTATCACTATGCTCGAGCATAGTGATAGTAAAGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027356.2-731s1c1
Sequence:CCGGGATTCCAATTCCTTCTACAACCTCGAGGTTGTAGAAGGAATTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027356.2-750s21c1
Sequence:CCGGACTTGTGCTTCACCAGAAATCCTCGAGGATTTCTGGTGAAGCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248559    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027356.2-822s21c1
Sequence:CCGGCTAAACACAGCCACCTATTTACTCGAGTAAATAGGTGGCTGTGTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027356.2-506s21c1
Sequence:CCGGGGAGAAGAGGAGCGGCTTTATCTCGAGATAAAGCCGCTCCTCTTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027356
UFSP1 MISSION shRNA Lentiviral Transduction Particles
UFM1-specific peptidase 1 (non-functional)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201692    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027356.1-821s1c1
Sequence:CCGGGACTAAACACAGCCACCTATTCTCGAGAATAGGTGGCTGTGTTTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190103    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027356.1-819s1c1
Sequence:CCGGGAGACTAAACACAGCCACCTACTCGAGTAGGTGGCTGTGTTTAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027356.2-612s21c1
Sequence:CCGGGGCCAGGTTCAGAAGTCTATGCTCGAGCATAGACTTCTGAACCTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027356.2-225s21c1
Sequence:CCGGACTACCTTTACTATCACTATGCTCGAGCATAGTGATAGTAAAGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027356.2-731s1c1
Sequence:CCGGGATTCCAATTCCTTCTACAACCTCGAGGTTGTAGAAGGAATTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027356.2-750s21c1
Sequence:CCGGACTTGTGCTTCACCAGAAATCCTCGAGGATTTCTGGTGAAGCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248559    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027356.2-822s21c1
Sequence:CCGGCTAAACACAGCCACCTATTTACTCGAGTAAATAGGTGGCTGTGTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027356.2-506s21c1
Sequence:CCGGGGAGAAGAGGAGCGGCTTTATCTCGAGATAAAGCCGCTCCTCTTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks