EMAIL THIS PAGE TO A FRIEND

UFSP2

UFM1-specific peptidase 2

Synonyms: C4orf20
UniProtKB ID: Q9NUQ7, Q6IA77, Q96FS3
Gene ID:
Human(55325) Summary: Like ubiquitin (see MIM 191339), ubiquitin-fold modifier-1 (UFM1; MIM 610553) must be processed by a protease before it can conjugate with its target proteins. UFSP2 is a thiol protease that specifically processes the C terminus of UFM1 (Kang et al., 2007 [PubMed 17182609]
Mouse(192169) UFM1-specific peptidase 2
Rat(361151) UFM1-specific peptidase 2
cow(617788) UFM1-specific peptidase 2
sheep(101112538) UFM1-specific peptidase 2
domestic guinea pig(100716911) UFM1-specific peptidase 2
naked mole-rat(101708908) UFM1-specific peptidase 2
Zebrafish(336782) ufm1-specific peptidase 2
Horse(100057294) UFM1-specific peptidase 2
domestic cat(101096562) UFM1-specific peptidase 2
dog(482908) UFM1-specific peptidase 2
chicken(422542) UFM1-specific peptidase 2
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018359 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018359 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018359 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138668 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138668 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138668 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU035911 MISSION® esiRNA esiRNA targeting mouse Ufsp2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018359 Rosetta Predictions human pricing
NM_001014142 Rosetta Predictions rat pricing
NM_138668 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018359 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212710 predicted 1306
2 SASI_Hs01_00212713 predicted 388
3 SASI_Hs01_00212714 predicted 287
4 SASI_Hs01_00212715 predicted 1120
5 SASI_Hs01_00212716 predicted 216
6 SASI_Hs01_00212717 predicted 261
7 SASI_Hs01_00212718 predicted 271
8 SASI_Hs01_00212719 predicted 964
9 SASI_Hs02_00351821 predicted 219
10 SASI_Hs02_00351822 predicted 1020
11 SASI_Hs01_00212711 predicted 1012
12 SASI_Hs01_00212712 predicted 890
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014142 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052510 predicted 606
2 SASI_Rn01_00052511 predicted 1020
3 SASI_Rn01_00052512 predicted 878
4 SASI_Rn01_00052513 predicted 1209
5 SASI_Rn01_00052515 predicted 212
6 SASI_Rn01_00052516 predicted 1063
7 SASI_Rn02_00201603 predicted 987
8 SASI_Rn01_00052517 predicted 1117
9 SASI_Rn01_00052518 predicted 714
10 SASI_Rn01_00052519 predicted 850
11 SASI_Rn01_00052514 predicted 1280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138668 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063792 predicted 1164
2 SASI_Mm01_00063793 predicted 1099
3 SASI_Mm01_00063794 predicted 1038
4 SASI_Mm01_00063796 predicted 876
5 SASI_Mm01_00063797 predicted 745
6 SASI_Mm01_00063798 predicted 795
7 SASI_Mm01_00063799 predicted 975
8 SASI_Mm01_00063800 predicted 298
9 SASI_Mm01_00063801 predicted 1126
10 SASI_Mm02_00339738 predicted 856
11 SASI_Mm01_00063795 predicted 1149
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018359
VALIDATED
UFSP2 MISSION shRNA Bacterial Glycerol Stock
UFM1-specific peptidase 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018359.3-1185s21c1
Sequence:CCGGGCAGCTGGTACTAAACCAATTCTCGAGAATTGGTTTAGTACCAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018359.3-1411s21c1
Sequence:CCGGGCTGAAGACCTGCAAGTTATTCTCGAGAATAACTTGCAGGTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018359.3-342s21c1
Sequence:CCGGGACTGATGCTTCTGCTTGTAACTCGAGTTACAAGCAGAAGCATCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018359.3-243s21c1
Sequence:CCGGGTCAACTAAGCTGTCTTCAAACTCGAGTTTGAAGACAGCTTAGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018359.1-271s1c1
Sequence:CCGGGACTGATGCTTCTGCTTGTAACTCGAGTTACAAGCAGAAGCATCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018359.1-172s1c1
Sequence:CCGGGTCAACTAAGCTGTCTTCAAACTCGAGTTTGAAGACAGCTTAGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018359.1-112s1c1
Sequence:CCGGGCTAGCTACTCCTAATGAAATCTCGAGATTTCATTAGGAGTAGCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018359.1-1340s1c1
Sequence:CCGGGCTGAAGACCTGCAAGTTATTCTCGAGAATAACTTGCAGGTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018359.1-1114s1c1
Sequence:CCGGGCAGCTGGTACTAAACCAATTCTCGAGAATTGGTTTAGTACCAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018359
VALIDATED
UFSP2 MISSION shRNA shRNA Plasmid DNA
UFM1-specific peptidase 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018359.3-1185s21c1
Sequence:CCGGGCAGCTGGTACTAAACCAATTCTCGAGAATTGGTTTAGTACCAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018359.3-1411s21c1
Sequence:CCGGGCTGAAGACCTGCAAGTTATTCTCGAGAATAACTTGCAGGTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018359.3-342s21c1
Sequence:CCGGGACTGATGCTTCTGCTTGTAACTCGAGTTACAAGCAGAAGCATCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018359.3-243s21c1
Sequence:CCGGGTCAACTAAGCTGTCTTCAAACTCGAGTTTGAAGACAGCTTAGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018359.1-271s1c1
Sequence:CCGGGACTGATGCTTCTGCTTGTAACTCGAGTTACAAGCAGAAGCATCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018359.1-172s1c1
Sequence:CCGGGTCAACTAAGCTGTCTTCAAACTCGAGTTTGAAGACAGCTTAGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018359.1-112s1c1
Sequence:CCGGGCTAGCTACTCCTAATGAAATCTCGAGATTTCATTAGGAGTAGCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018359.1-1340s1c1
Sequence:CCGGGCTGAAGACCTGCAAGTTATTCTCGAGAATAACTTGCAGGTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018359.1-1114s1c1
Sequence:CCGGGCAGCTGGTACTAAACCAATTCTCGAGAATTGGTTTAGTACCAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018359
VALIDATED
UFSP2 MISSION shRNA Lentiviral Transduction Particles
UFM1-specific peptidase 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018359.3-1185s21c1
Sequence:CCGGGCAGCTGGTACTAAACCAATTCTCGAGAATTGGTTTAGTACCAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018359.3-1411s21c1
Sequence:CCGGGCTGAAGACCTGCAAGTTATTCTCGAGAATAACTTGCAGGTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018359.3-342s21c1
Sequence:CCGGGACTGATGCTTCTGCTTGTAACTCGAGTTACAAGCAGAAGCATCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018359.3-243s21c1
Sequence:CCGGGTCAACTAAGCTGTCTTCAAACTCGAGTTTGAAGACAGCTTAGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018359.1-271s1c1
Sequence:CCGGGACTGATGCTTCTGCTTGTAACTCGAGTTACAAGCAGAAGCATCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018359.1-172s1c1
Sequence:CCGGGTCAACTAAGCTGTCTTCAAACTCGAGTTTGAAGACAGCTTAGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018359.1-112s1c1
Sequence:CCGGGCTAGCTACTCCTAATGAAATCTCGAGATTTCATTAGGAGTAGCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018359.1-1340s1c1
Sequence:CCGGGCTGAAGACCTGCAAGTTATTCTCGAGAATAACTTGCAGGTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018359.1-1114s1c1
Sequence:CCGGGCAGCTGGTACTAAACCAATTCTCGAGAATTGGTTTAGTACCAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138668
VALIDATED
UFSP2 MISSION shRNA Bacterial Glycerol Stock
UFM1-specific peptidase 2
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138668.1-332s1c1
Sequence:CCGGGATCAAGAGGAGGATACAAAGCTCGAGCTTTGTATCCTCCTCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138668.1-389s1c1
Sequence:CCGGGACACGCAACAGATAGTAAATCTCGAGATTTACTATCTGTTGCGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138668.1-310s1c1
Sequence:CCGGCGTAGTGCGCTTCATTCAATTCTCGAGAATTGAATGAAGCGCACTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138668.1-795s1c1
Sequence:CCGGGGATCAATGCTTATCACTTTCCTCGAGGAAAGTGATAAGCATTGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138668.1-769s1c1
Sequence:CCGGGCCTCATGACAGACCTTATTTCTCGAGAAATAAGGTCTGTCATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138668.1-734s1c1
Sequence:CCGGGCCTATCGAAAGGAGTTACATCTCGAGATGTAACTCCTTTCGATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138668.1-558s1c1
Sequence:CCGGGCAAACTTCTAGTGGATGCAACTCGAGTTGCATCCACTAGAAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138668.1-137s1c1
Sequence:CCGGGCACCACCTAAAGAAATGTTTCTCGAGAAACATTTCTTTAGGTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181248    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138668.1-731s1c1
Sequence:CCGGCAAGCCTATCGAAAGGAGTTACTCGAGTAACTCCTTTCGATAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138668.1-909s1c1
Sequence:CCGGGCACCTATGCTTATCATCATTCTCGAGAATGATGATAAGCATAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138668.1-837s1c1
Sequence:CCGGGCTATATCAGAAACCCACATACTCGAGTATGTGGGTTTCTGATATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138668
VALIDATED
UFSP2 MISSION shRNA shRNA Plasmid DNA
UFM1-specific peptidase 2
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138668.1-332s1c1
Sequence:CCGGGATCAAGAGGAGGATACAAAGCTCGAGCTTTGTATCCTCCTCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138668.1-389s1c1
Sequence:CCGGGACACGCAACAGATAGTAAATCTCGAGATTTACTATCTGTTGCGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138668.1-310s1c1
Sequence:CCGGCGTAGTGCGCTTCATTCAATTCTCGAGAATTGAATGAAGCGCACTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138668.1-795s1c1
Sequence:CCGGGGATCAATGCTTATCACTTTCCTCGAGGAAAGTGATAAGCATTGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138668.1-769s1c1
Sequence:CCGGGCCTCATGACAGACCTTATTTCTCGAGAAATAAGGTCTGTCATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138668.1-734s1c1
Sequence:CCGGGCCTATCGAAAGGAGTTACATCTCGAGATGTAACTCCTTTCGATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138668.1-558s1c1
Sequence:CCGGGCAAACTTCTAGTGGATGCAACTCGAGTTGCATCCACTAGAAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138668.1-137s1c1
Sequence:CCGGGCACCACCTAAAGAAATGTTTCTCGAGAAACATTTCTTTAGGTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181248    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138668.1-731s1c1
Sequence:CCGGCAAGCCTATCGAAAGGAGTTACTCGAGTAACTCCTTTCGATAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138668.1-909s1c1
Sequence:CCGGGCACCTATGCTTATCATCATTCTCGAGAATGATGATAAGCATAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138668.1-837s1c1
Sequence:CCGGGCTATATCAGAAACCCACATACTCGAGTATGTGGGTTTCTGATATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138668
VALIDATED
UFSP2 MISSION shRNA Lentiviral Transduction Particles
UFM1-specific peptidase 2
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138668.1-332s1c1
Sequence:CCGGGATCAAGAGGAGGATACAAAGCTCGAGCTTTGTATCCTCCTCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138668.1-389s1c1
Sequence:CCGGGACACGCAACAGATAGTAAATCTCGAGATTTACTATCTGTTGCGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138668.1-310s1c1
Sequence:CCGGCGTAGTGCGCTTCATTCAATTCTCGAGAATTGAATGAAGCGCACTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138668.1-795s1c1
Sequence:CCGGGGATCAATGCTTATCACTTTCCTCGAGGAAAGTGATAAGCATTGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138668.1-769s1c1
Sequence:CCGGGCCTCATGACAGACCTTATTTCTCGAGAAATAAGGTCTGTCATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138668.1-734s1c1
Sequence:CCGGGCCTATCGAAAGGAGTTACATCTCGAGATGTAACTCCTTTCGATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138668.1-558s1c1
Sequence:CCGGGCAAACTTCTAGTGGATGCAACTCGAGTTGCATCCACTAGAAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138668.1-137s1c1
Sequence:CCGGGCACCACCTAAAGAAATGTTTCTCGAGAAACATTTCTTTAGGTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181248    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138668.1-731s1c1
Sequence:CCGGCAAGCCTATCGAAAGGAGTTACTCGAGTAACTCCTTTCGATAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138668.1-909s1c1
Sequence:CCGGGCACCTATGCTTATCATCATTCTCGAGAATGATGATAAGCATAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138668.1-837s1c1
Sequence:CCGGGCTATATCAGAAACCCACATACTCGAGTATGTGGGTTTCTGATATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks