EMAIL THIS PAGE TO A FRIEND

UGCG

UDP-glucose ceramide glucosyltransferase

Synonyms: GCS GLCT1
UniProtKB ID: Q16739, Q5T258
Gene ID:
Human(7357) Summary: Glycosphingolipids (GSLs) are a group of membrane components that contain lipid and sugar moieties. They are present in essentially all animal cells and are believed to have important roles in various cellular processes. UDP-glucose ceramide glucosyltransferase catalyzes the first glycosylation step in glycosphingolipid biosynthesis. The product, glucosylceramide, is the core structure of more than 300 GSLs. UGCG is widely expressed and transcription is upregulated during keratinocyte differentiation. [provided by RefSeq, Oct 2009]
Mouse(22234) UDP-glucose ceramide glucosyltransferase
Rat(83626) UDP-glucose ceramide glucosyltransferase
domestic guinea pig(100730880) UDP-glucose ceramide glucosyltransferase
cow(514357) UDP-glucose ceramide glucosyltransferase
sheep(101111687) UDP-glucose ceramide glucosyltransferase
Zebrafish(553944) UDP-glucose ceramide glucosyltransferase
chicken(427335) UDP-glucose ceramide glucosyltransferase
domestic cat(101101006) UDP-glucose ceramide glucosyltransferase
Horse(100057611) UDP-glucose ceramide glucosyltransferase
dog(481666) UDP-glucose ceramide glucosyltransferase
76 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
B8299 N-Butyldeoxynojirimycin film (dried in situ) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003358 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003358 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003358 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011673 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011673 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011673 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU072381 MISSION® esiRNA esiRNA targeting mouse Ugcg (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003358 Rosetta Predictions human pricing
NM_031795 Rosetta Predictions rat pricing
XM_579533 Rosetta Predictions rat pricing
NM_011673 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003358 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050364 predicted 1065
2 SASI_Hs01_00050365 predicted 685
3 SASI_Hs01_00050366 predicted 984
4 SASI_Hs02_00335506 predicted 493
5 SASI_Hs01_00050367 predicted 613
6 SASI_Hs01_00050368 predicted 1255
7 SASI_Hs01_00050370 predicted 857
8 SASI_Hs01_00050371 predicted 875
9 SASI_Hs01_00050372 predicted 728
10 SASI_Hs01_00050373 predicted 976
11 SASI_Hs01_00050369 predicted 1253
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031795 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109036 predicted 862
2 SASI_Rn01_00109037 predicted 443
3 SASI_Rn01_00109038 predicted 986
4 SASI_Rn01_00109039 predicted 451
5 SASI_Rn01_00109040 predicted 716
6 SASI_Rn01_00109041 predicted 295
7 SASI_Rn01_00109042 predicted 466
8 SASI_Rn01_00109043 predicted 403
9 SASI_Rn01_00109044 predicted 339
10 SASI_Rn01_00109045 predicted 841
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579533 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00167569 predicted 866
2 SASI_Rn01_00167570 predicted 445
3 SASI_Rn01_00167571 predicted 986
4 SASI_Rn01_00167572 predicted 451
5 SASI_Rn01_00167573 predicted 719
6 SASI_Rn01_00167574 predicted 290
7 SASI_Rn01_00167575 predicted 473
8 SASI_Rn01_00167576 predicted 405
9 SASI_Rn01_00167577 predicted 340
10 SASI_Rn01_00167578 predicted 836
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011673 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025944 predicted 1153
2 SASI_Mm01_00025945 predicted 1061
3 SASI_Mm01_00025947 predicted 878
4 SASI_Mm01_00025948 predicted 480
5 SASI_Mm01_00025949 predicted 1013
6 SASI_Mm01_00025950 predicted 672
7 SASI_Mm02_00321198 predicted 369
8 SASI_Mm01_00025951 predicted 787
9 SASI_Mm01_00025952 predicted 1024
10 SASI_Mm02_00321199 predicted 542
11 SASI_Mm01_00025946 predicted 510
12 SASI_Mm01_00025953 predicted 856
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003358
VALIDATED
UGCG MISSION shRNA Bacterial Glycerol Stock
UDP-glucose ceramide glucosyltransferase
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003358.1-1452s1c1
Sequence:CCGGGCAGAGGAAATCCTAGATGTACTCGAGTACATCTAGGATTTCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003358.1-1355s1c1
Sequence:CCGGCCGCGAATCCATGACAATATACTCGAGTATATTGTCATGGATTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003358.1-864s21c1
Sequence:CCGGTCACATCCAAGATACTATATCCTCGAGGATATAGTATCTTGGATGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_003358.1-1355s21c1
Sequence:CCGGCCGCGAATCCATGACAATATACTCGAGTATATTGTCATGGATTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_003358.1-978s21c1
Sequence:CCGGGCTCAGTACATTGCCGAAGATCTCGAGATCTTCGGCAATGTACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_003358.1-1389s21c1
Sequence:CCGGGCATTATGGGACCCAACTATACTCGAGTATAGTTGGGTCCCATAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_003358.1-1115s21c1
Sequence:CCGGGTGGACCAAACTACGAATTAACTCGAGTTAATTCGTAGTTTGGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003358
VALIDATED
UGCG MISSION shRNA shRNA Plasmid DNA
UDP-glucose ceramide glucosyltransferase
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003358.1-1452s1c1
Sequence:CCGGGCAGAGGAAATCCTAGATGTACTCGAGTACATCTAGGATTTCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003358.1-1355s1c1
Sequence:CCGGCCGCGAATCCATGACAATATACTCGAGTATATTGTCATGGATTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003358.1-864s21c1
Sequence:CCGGTCACATCCAAGATACTATATCCTCGAGGATATAGTATCTTGGATGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_003358.1-1355s21c1
Sequence:CCGGCCGCGAATCCATGACAATATACTCGAGTATATTGTCATGGATTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_003358.1-978s21c1
Sequence:CCGGGCTCAGTACATTGCCGAAGATCTCGAGATCTTCGGCAATGTACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_003358.1-1389s21c1
Sequence:CCGGGCATTATGGGACCCAACTATACTCGAGTATAGTTGGGTCCCATAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_003358.1-1115s21c1
Sequence:CCGGGTGGACCAAACTACGAATTAACTCGAGTTAATTCGTAGTTTGGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003358
VALIDATED
UGCG MISSION shRNA Lentiviral Transduction Particles
UDP-glucose ceramide glucosyltransferase
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003358.1-1452s1c1
Sequence:CCGGGCAGAGGAAATCCTAGATGTACTCGAGTACATCTAGGATTTCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003358.1-1355s1c1
Sequence:CCGGCCGCGAATCCATGACAATATACTCGAGTATATTGTCATGGATTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003358.1-864s21c1
Sequence:CCGGTCACATCCAAGATACTATATCCTCGAGGATATAGTATCTTGGATGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_003358.1-1355s21c1
Sequence:CCGGCCGCGAATCCATGACAATATACTCGAGTATATTGTCATGGATTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_003358.1-978s21c1
Sequence:CCGGGCTCAGTACATTGCCGAAGATCTCGAGATCTTCGGCAATGTACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_003358.1-1389s21c1
Sequence:CCGGGCATTATGGGACCCAACTATACTCGAGTATAGTTGGGTCCCATAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_003358.1-1115s21c1
Sequence:CCGGGTGGACCAAACTACGAATTAACTCGAGTTAATTCGTAGTTTGGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011673
VALIDATED
UGCG MISSION shRNA Bacterial Glycerol Stock
UDP-glucose ceramide glucosyltransferase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093764    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011673.2-2069s1c1
Sequence:CCGGCCATGAATTGAAGGCATCTTTCTCGAGAAAGATGCCTTCAATTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011673.2-1018s1c1
Sequence:CCGGCCATGTATTCAGATGGGATATCTCGAGATATCCCATCTGAATACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011673.2-1159s1c1
Sequence:CCGGCCGTGAATCCATGACAATCTACTCGAGTAGATTGTCATGGATTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011673.2-411s1c1
Sequence:CCGGCAAATGTCGATGCTAGATTATCTCGAGATAATCTAGCATCGACATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011673.2-374s1c1
Sequence:CCGGGCCATTGATGTATGTAAGAAACTCGAGTTTCTTACATACATCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011673.3-1159s21c1
Sequence:CCGGCCGTGAATCCATGACAATCTACTCGAGTAGATTGTCATGGATTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011673.3-1018s21c1
Sequence:CCGGCCATGTATTCAGATGGGATATCTCGAGATATCCCATCTGAATACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011673.3-374s21c1
Sequence:CCGGGCCATTGATGTATGTAAGAAACTCGAGTTTCTTACATACATCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011673.3-411s21c1
Sequence:CCGGCAAATGTCGATGCTAGATTATCTCGAGATAATCTAGCATCGACATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316762    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011673.3-2074s21c1
Sequence:CCGGCCATGAATTGAAGGCATCTTTCTCGAGAAAGATGCCTTCAATTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011673
VALIDATED
UGCG MISSION shRNA shRNA Plasmid DNA
UDP-glucose ceramide glucosyltransferase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093764    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011673.2-2069s1c1
Sequence:CCGGCCATGAATTGAAGGCATCTTTCTCGAGAAAGATGCCTTCAATTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011673.2-1018s1c1
Sequence:CCGGCCATGTATTCAGATGGGATATCTCGAGATATCCCATCTGAATACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011673.2-1159s1c1
Sequence:CCGGCCGTGAATCCATGACAATCTACTCGAGTAGATTGTCATGGATTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011673.2-411s1c1
Sequence:CCGGCAAATGTCGATGCTAGATTATCTCGAGATAATCTAGCATCGACATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011673.2-374s1c1
Sequence:CCGGGCCATTGATGTATGTAAGAAACTCGAGTTTCTTACATACATCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011673.3-1159s21c1
Sequence:CCGGCCGTGAATCCATGACAATCTACTCGAGTAGATTGTCATGGATTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011673.3-1018s21c1
Sequence:CCGGCCATGTATTCAGATGGGATATCTCGAGATATCCCATCTGAATACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011673.3-374s21c1
Sequence:CCGGGCCATTGATGTATGTAAGAAACTCGAGTTTCTTACATACATCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011673.3-411s21c1
Sequence:CCGGCAAATGTCGATGCTAGATTATCTCGAGATAATCTAGCATCGACATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316762    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011673.3-2074s21c1
Sequence:CCGGCCATGAATTGAAGGCATCTTTCTCGAGAAAGATGCCTTCAATTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011673
VALIDATED
UGCG MISSION shRNA Lentiviral Transduction Particles
UDP-glucose ceramide glucosyltransferase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093764    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011673.2-2069s1c1
Sequence:CCGGCCATGAATTGAAGGCATCTTTCTCGAGAAAGATGCCTTCAATTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011673.2-1018s1c1
Sequence:CCGGCCATGTATTCAGATGGGATATCTCGAGATATCCCATCTGAATACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011673.2-1159s1c1
Sequence:CCGGCCGTGAATCCATGACAATCTACTCGAGTAGATTGTCATGGATTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011673.2-411s1c1
Sequence:CCGGCAAATGTCGATGCTAGATTATCTCGAGATAATCTAGCATCGACATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011673.2-374s1c1
Sequence:CCGGGCCATTGATGTATGTAAGAAACTCGAGTTTCTTACATACATCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011673.3-1159s21c1
Sequence:CCGGCCGTGAATCCATGACAATCTACTCGAGTAGATTGTCATGGATTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011673.3-1018s21c1
Sequence:CCGGCCATGTATTCAGATGGGATATCTCGAGATATCCCATCTGAATACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011673.3-374s21c1
Sequence:CCGGGCCATTGATGTATGTAAGAAACTCGAGTTTCTTACATACATCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011673.3-411s21c1
Sequence:CCGGCAAATGTCGATGCTAGATTATCTCGAGATAATCTAGCATCGACATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316762    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011673.3-2074s21c1
Sequence:CCGGCCATGAATTGAAGGCATCTTTCTCGAGAAAGATGCCTTCAATTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks