EMAIL THIS PAGE TO A FRIEND

UGDH

UDP-glucose 6-dehydrogenase

Synonyms: GDH UDP-GlcDH UDPGDH UGD
UniProtKB ID: O60701, B3KUU2, B4DN25, O60589
Gene ID:
Human(7358) Summary: The protein encoded by this gene converts UDP-glucose to UDP-glucuronate and thereby participates in the biosynthesis of glycosaminoglycans such as hyaluronan, chondroitin sulfate, and heparan sulfate. These glycosylated compounds are common components of the extracellular matrix and likely play roles in signal transduction, cell migration, and cancer growth and metastasis. The expression of this gene is up-regulated by transforming growth factor beta and down-regulated by hypoxia. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
Mouse(22235) UDP-glucose dehydrogenase
Rat(83472) UDP-glucose 6-dehydrogenase
Zebrafish(116991) UDP-glucose dehydrogenase
Horse(100055067) UDP-glucose 6-dehydrogenase
domestic cat(101083081) UDP-glucose 6-dehydrogenase
dog(479107) UDP-glucose 6-dehydrogenase
chicken(422792) UDP-glucose 6-dehydrogenase
cow(281564) UDP-glucose 6-dehydrogenase
sheep(101114271) UDP-glucose 6-dehydrogenase
domestic guinea pig(100714768) UDP-glucose 6-dehydrogenase
naked mole-rat(101726266) UDP-glucose 6-dehydrogenase
Domestic Rabbit(100355018) UDP-glucose 6-dehydrogenase
74 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009466 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009466 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009466 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003359 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003359 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003359 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003359 Rosetta Predictions human pricing
NM_031325 Rosetta Predictions rat pricing
NM_009466 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003359 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155309 predicted 1075
2 SASI_Hs01_00155310 predicted 1496
3 SASI_Hs01_00155311 predicted 792
4 SASI_Hs01_00155314 predicted 1499
5 SASI_Hs01_00155315 predicted 1576
6 SASI_Hs02_00335507 predicted 1335
7 SASI_Hs02_00335508 predicted 1563
8 SASI_Hs02_00335509 predicted 960
9 SASI_Hs01_00155312 predicted 1199
10 SASI_Hs01_00155313 predicted 1265
11 SASI_Hs01_00155316 predicted 1150
12 SASI_Hs01_00155317 predicted 1211
13 SASI_Hs01_00155318 predicted 823
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031325 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068939 predicted 1483
2 SASI_Rn01_00068940 predicted 1370
3 SASI_Rn01_00068941 predicted 1156
4 SASI_Rn01_00068942 predicted 1227
5 SASI_Rn01_00068943 predicted 1564
6 SASI_Rn01_00068944 predicted 975
7 SASI_Rn01_00068945 predicted 946
8 SASI_Rn01_00068946 predicted 286
9 SASI_Rn01_00068947 predicted 1083
10 SASI_Rn01_00068948 predicted 1521
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009466 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107208 predicted 1754
2 SASI_Mm01_00107209 predicted 1449
3 SASI_Mm01_00107210 predicted 1598
4 SASI_Mm01_00107211 predicted 1723
5 SASI_Mm01_00107212 predicted 1678
6 SASI_Mm01_00107213 predicted 1339
7 SASI_Mm01_00107214 predicted 1622
8 SASI_Mm01_00107215 predicted 1242
9 SASI_Mm01_00107216 predicted 723
10 SASI_Mm01_00107217 predicted 1089
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009466
VALIDATED
UGDH MISSION shRNA Bacterial Glycerol Stock
UDP-glucose 6-dehydrogenase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009466.2-465s21c1
Sequence:CCGGGAGAAGCCGATCTAGTATTTACTCGAGTAAATACTAGATCGGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009466.2-336s21c1
Sequence:CCGGTCAACGAGGCAAGGATCAATGCTCGAGCATTGATCCTTGCCTCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009466.2-1495s21c1
Sequence:CCGGGGATTACGAACGGATTCATAACTCGAGTTATGAATCCGTTCGTAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337653    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009466.2-1831s21c1
Sequence:CCGGATACTAGCTATATGGGTATTACTCGAGTAATACCCATATAGCTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009466.2-1650s21c1
Sequence:CCGGCTGGTGAGATTCCGAAGTTTACTCGAGTAAACTTCGGAATCTCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009466.2-1175s1c1
Sequence:CCGGCGGATCATAGATAGCCTGTTTCTCGAGAAACAGGCTATCTATGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009466.2-651s1c1
Sequence:CCGGGCATATTTGATGCCAACACAACTCGAGTTGTGTTGGCATCAAATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009466.2-1649s1c1
Sequence:CCGGCCTGGTGAGATTCCGAAGTTTCTCGAGAAACTTCGGAATCTCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009466.2-1681s1c1
Sequence:CCGGCCCACCTAACAAGAAACCCAACTCGAGTTGGGTTTCTTGTTAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009466.2-377s1c1
Sequence:CCGGCCTATTTATGAGCCTGGATTACTCGAGTAATCCAGGCTCATAAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009466
VALIDATED
UGDH MISSION shRNA shRNA Plasmid DNA
UDP-glucose 6-dehydrogenase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009466.2-465s21c1
Sequence:CCGGGAGAAGCCGATCTAGTATTTACTCGAGTAAATACTAGATCGGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009466.2-336s21c1
Sequence:CCGGTCAACGAGGCAAGGATCAATGCTCGAGCATTGATCCTTGCCTCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009466.2-1495s21c1
Sequence:CCGGGGATTACGAACGGATTCATAACTCGAGTTATGAATCCGTTCGTAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337653    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009466.2-1831s21c1
Sequence:CCGGATACTAGCTATATGGGTATTACTCGAGTAATACCCATATAGCTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009466.2-1650s21c1
Sequence:CCGGCTGGTGAGATTCCGAAGTTTACTCGAGTAAACTTCGGAATCTCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009466.2-1175s1c1
Sequence:CCGGCGGATCATAGATAGCCTGTTTCTCGAGAAACAGGCTATCTATGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009466.2-651s1c1
Sequence:CCGGGCATATTTGATGCCAACACAACTCGAGTTGTGTTGGCATCAAATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009466.2-1649s1c1
Sequence:CCGGCCTGGTGAGATTCCGAAGTTTCTCGAGAAACTTCGGAATCTCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009466.2-1681s1c1
Sequence:CCGGCCCACCTAACAAGAAACCCAACTCGAGTTGGGTTTCTTGTTAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009466.2-377s1c1
Sequence:CCGGCCTATTTATGAGCCTGGATTACTCGAGTAATCCAGGCTCATAAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009466
VALIDATED
UGDH MISSION shRNA Lentiviral Transduction Particles
UDP-glucose 6-dehydrogenase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009466.2-465s21c1
Sequence:CCGGGAGAAGCCGATCTAGTATTTACTCGAGTAAATACTAGATCGGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009466.2-336s21c1
Sequence:CCGGTCAACGAGGCAAGGATCAATGCTCGAGCATTGATCCTTGCCTCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009466.2-1495s21c1
Sequence:CCGGGGATTACGAACGGATTCATAACTCGAGTTATGAATCCGTTCGTAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337653    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009466.2-1831s21c1
Sequence:CCGGATACTAGCTATATGGGTATTACTCGAGTAATACCCATATAGCTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009466.2-1650s21c1
Sequence:CCGGCTGGTGAGATTCCGAAGTTTACTCGAGTAAACTTCGGAATCTCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009466.2-1175s1c1
Sequence:CCGGCGGATCATAGATAGCCTGTTTCTCGAGAAACAGGCTATCTATGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009466.2-651s1c1
Sequence:CCGGGCATATTTGATGCCAACACAACTCGAGTTGTGTTGGCATCAAATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009466.2-1649s1c1
Sequence:CCGGCCTGGTGAGATTCCGAAGTTTCTCGAGAAACTTCGGAATCTCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009466.2-1681s1c1
Sequence:CCGGCCCACCTAACAAGAAACCCAACTCGAGTTGGGTTTCTTGTTAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009466.2-377s1c1
Sequence:CCGGCCTATTTATGAGCCTGGATTACTCGAGTAATCCAGGCTCATAAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003359
VALIDATED
UGDH MISSION shRNA Bacterial Glycerol Stock
UDP-glucose 6-dehydrogenase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000280879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003359.2-548s21c1
Sequence:CCGGGCCATCAAAGAAGCTGATCTTCTCGAGAAGATCAGCTTCTTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_003359.2-414s21c1
Sequence:CCGGCGGTTGTTGATGTCAATGAATCTCGAGATTCATTGACATCAACAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003359.2-736s21c1
Sequence:CCGGCCGTCGCATATTTGATGCAAACTCGAGTTTGCATCAAATATGCGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003359.2-1754s21c1
Sequence:CCGGCCGAAGTTTAGTCTTCAAGATCTCGAGATCTTGAAGACTAAACTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_003359.1-1516s1c1
Sequence:CCGGCCGAAGTTTAGTCTTCAAGATCTCGAGATCTTGAAGACTAAACTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003359.1-310s1c1
Sequence:CCGGGCCATCAAAGAAGCTGATCTTCTCGAGAAGATCAGCTTCTTTGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003359.1-176s1c1
Sequence:CCGGCGGTTGTTGATGTCAATGAATCTCGAGATTCATTGACATCAACAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003359.1-1027s1c1
Sequence:CCGGCGGATCATAGATAGTCTGTTTCTCGAGAAACAGACTATCTATGATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_003359.1-498s1c1
Sequence:CCGGCCGTCGCATATTTGATGCAAACTCGAGTTTGCATCAAATATGCGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003359
VALIDATED
UGDH MISSION shRNA shRNA Plasmid DNA
UDP-glucose 6-dehydrogenase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000280879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003359.2-548s21c1
Sequence:CCGGGCCATCAAAGAAGCTGATCTTCTCGAGAAGATCAGCTTCTTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_003359.2-414s21c1
Sequence:CCGGCGGTTGTTGATGTCAATGAATCTCGAGATTCATTGACATCAACAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003359.2-736s21c1
Sequence:CCGGCCGTCGCATATTTGATGCAAACTCGAGTTTGCATCAAATATGCGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003359.2-1754s21c1
Sequence:CCGGCCGAAGTTTAGTCTTCAAGATCTCGAGATCTTGAAGACTAAACTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_003359.1-1516s1c1
Sequence:CCGGCCGAAGTTTAGTCTTCAAGATCTCGAGATCTTGAAGACTAAACTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003359.1-310s1c1
Sequence:CCGGGCCATCAAAGAAGCTGATCTTCTCGAGAAGATCAGCTTCTTTGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003359.1-176s1c1
Sequence:CCGGCGGTTGTTGATGTCAATGAATCTCGAGATTCATTGACATCAACAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003359.1-1027s1c1
Sequence:CCGGCGGATCATAGATAGTCTGTTTCTCGAGAAACAGACTATCTATGATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_003359.1-498s1c1
Sequence:CCGGCCGTCGCATATTTGATGCAAACTCGAGTTTGCATCAAATATGCGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003359
VALIDATED
UGDH MISSION shRNA Lentiviral Transduction Particles
UDP-glucose 6-dehydrogenase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000280879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003359.2-548s21c1
Sequence:CCGGGCCATCAAAGAAGCTGATCTTCTCGAGAAGATCAGCTTCTTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_003359.2-414s21c1
Sequence:CCGGCGGTTGTTGATGTCAATGAATCTCGAGATTCATTGACATCAACAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003359.2-736s21c1
Sequence:CCGGCCGTCGCATATTTGATGCAAACTCGAGTTTGCATCAAATATGCGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003359.2-1754s21c1
Sequence:CCGGCCGAAGTTTAGTCTTCAAGATCTCGAGATCTTGAAGACTAAACTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_003359.1-1516s1c1
Sequence:CCGGCCGAAGTTTAGTCTTCAAGATCTCGAGATCTTGAAGACTAAACTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003359.1-310s1c1
Sequence:CCGGGCCATCAAAGAAGCTGATCTTCTCGAGAAGATCAGCTTCTTTGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003359.1-176s1c1
Sequence:CCGGCGGTTGTTGATGTCAATGAATCTCGAGATTCATTGACATCAACAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003359.1-1027s1c1
Sequence:CCGGCGGATCATAGATAGTCTGTTTCTCGAGAAACAGACTATCTATGATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_003359.1-498s1c1
Sequence:CCGGCCGTCGCATATTTGATGCAAACTCGAGTTTGCATCAAATATGCGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks