EMAIL THIS PAGE TO A FRIEND

UGGT1

UDP-glucose glycoprotein glucosyltransferase 1

Synonyms: HUGT1 UGCGL1 UGT1
UniProtKB ID: Q9NYU2, Q53QP2, Q53SL3, Q8IW30, Q9H8I4
Gene ID:
Human(56886) Summary: UDP-glucose:glycoprotein glucosyltransferase (UGT) is a soluble protein of the endoplasmic reticulum (ER) that selectively reglucosylates unfolded glycoproteins, thus providing quality control for protein transport out of the ER.[supplied by OMIM, Oct 2009]
Mouse(320011) UDP-glucose glycoprotein glucosyltransferase 1
Rat(171129) UDP-glucose glycoprotein glucosyltransferase 1
Zebrafish(553288) UDP-glucose glycoprotein glucosyltransferase 1
dog(476101) UDP-glucose glycoprotein glucosyltransferase 1
Horse(100067440) UDP-glucose glycoprotein glucosyltransferase 1
domestic cat(101091643) UDP-glucose glycoprotein glucosyltransferase 1
chicken(424757) UDP-glucose glycoprotein glucosyltransferase 1
naked mole-rat(101718371) UDP-glucose glycoprotein glucosyltransferase 1
domestic guinea pig(100726435) UDP-glucose glycoprotein glucosyltransferase 1
cow(516332) UDP-glucose glycoprotein glucosyltransferase 1
sheep(101106911) UDP-glucose glycoprotein glucosyltransferase 1
89 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198899 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198899 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198899 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020120 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020120 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020120 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025777 Rosetta Predictions human pricing
NM_020120 Rosetta Predictions human pricing
NM_133596 Rosetta Predictions rat pricing
NM_198899 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025777 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307485 predicted 2441
2 SASI_Hs01_00090599 predicted 1509
3 SASI_Hs01_00090600 predicted 2387
4 SASI_Hs01_00090601 predicted 3585
5 SASI_Hs01_00090602 predicted 2159
6 SASI_Hs01_00090603 predicted 735
7 SASI_Hs01_00090604 predicted 3431
8 SASI_Hs01_00090605 predicted 604
9 SASI_Hs02_00307486 predicted 4565
10 SASI_Hs01_00090608 predicted 874
11 SASI_Hs01_00090606 predicted 2406
12 SASI_Hs01_00090607 predicted 2532
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020120 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352979 predicted 2153
2 SASI_Hs01_00051209 predicted 1221
3 SASI_Hs01_00051210 predicted 2099
4 SASI_Hs01_00051211 predicted 3295
5 SASI_Hs01_00051212 predicted 1865
6 SASI_Hs01_00051213 predicted 452
7 SASI_Hs01_00051214 predicted 3143
8 SASI_Hs01_00051215 predicted 316
9 SASI_Hs02_00352980 predicted 4283
10 SASI_Hs01_00051218 predicted 587
11 SASI_Hs01_00051216 predicted 2114
12 SASI_Hs01_00051217 predicted 2240
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133596 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041186 predicted 482
2 SASI_Rn01_00041187 predicted 1299
3 SASI_Rn01_00041188 predicted 3298
4 SASI_Rn01_00041189 predicted 3494
5 SASI_Rn01_00041190 predicted 1330
6 SASI_Rn01_00041191 predicted 1408
7 SASI_Rn01_00041192 predicted 2325
8 SASI_Rn01_00041193 predicted 2874
9 SASI_Rn01_00041195 predicted 2291
10 SASI_Rn02_00267807 predicted 2035
11 SASI_Rn01_00041194 predicted 1361
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198899 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067204 predicted 862
2 SASI_Mm02_00351215 predicted 4594
3 SASI_Mm01_00067205 predicted 1515
4 SASI_Mm01_00067206 predicted 1456
5 SASI_Mm01_00067207 predicted 2328
6 SASI_Mm01_00067208 predicted 1596
7 SASI_Mm01_00067210 predicted 2479
8 SASI_Mm01_00067211 predicted 1983
9 SASI_Mm01_00067212 predicted 3645
10 SASI_Mm02_00351216 predicted 3376
11 SASI_Mm01_00067209 predicted 1486
12 SASI_Mm01_00067213 predicted 2080
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198899
VALIDATED
UGGT1 MISSION shRNA Bacterial Glycerol Stock
UDP-glucose glycoprotein glucosyltransferase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110450    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198899.1-4885s1c1
Sequence:CCGGCCTATTGATCTGAGCATTGATCTCGAGATCAATGCTCAGATCAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_198899.1-2482s1c1
Sequence:CCGGCCAGTAACAATGTTAGGATAACTCGAGTTATCCTAACATTGTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_198899.1-1334s1c1
Sequence:CCGGCCAGGATATATTCAGTCTATTCTCGAGAATAGACTGAATATATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_198899.1-645s1c1
Sequence:CCGGCCGAAACCATTATTGTTCAAACTCGAGTTTGAACAATAATGGTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198899.1-4011s1c1
Sequence:CCGGCCCACATTTAAGGAGTTTATACTCGAGTATAAACTCCTTAAATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198899
VALIDATED
UGGT1 MISSION shRNA shRNA Plasmid DNA
UDP-glucose glycoprotein glucosyltransferase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110450    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198899.1-4885s1c1
Sequence:CCGGCCTATTGATCTGAGCATTGATCTCGAGATCAATGCTCAGATCAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_198899.1-2482s1c1
Sequence:CCGGCCAGTAACAATGTTAGGATAACTCGAGTTATCCTAACATTGTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_198899.1-1334s1c1
Sequence:CCGGCCAGGATATATTCAGTCTATTCTCGAGAATAGACTGAATATATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_198899.1-645s1c1
Sequence:CCGGCCGAAACCATTATTGTTCAAACTCGAGTTTGAACAATAATGGTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198899.1-4011s1c1
Sequence:CCGGCCCACATTTAAGGAGTTTATACTCGAGTATAAACTCCTTAAATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198899
VALIDATED
UGGT1 MISSION shRNA Lentiviral Transduction Particles
UDP-glucose glycoprotein glucosyltransferase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110450    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198899.1-4885s1c1
Sequence:CCGGCCTATTGATCTGAGCATTGATCTCGAGATCAATGCTCAGATCAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_198899.1-2482s1c1
Sequence:CCGGCCAGTAACAATGTTAGGATAACTCGAGTTATCCTAACATTGTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_198899.1-1334s1c1
Sequence:CCGGCCAGGATATATTCAGTCTATTCTCGAGAATAGACTGAATATATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_198899.1-645s1c1
Sequence:CCGGCCGAAACCATTATTGTTCAAACTCGAGTTTGAACAATAATGGTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198899.1-4011s1c1
Sequence:CCGGCCCACATTTAAGGAGTTTATACTCGAGTATAAACTCCTTAAATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020120
UGGT1 MISSION shRNA Bacterial Glycerol Stock
UDP-glucose glycoprotein glucosyltransferase 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020120.x-1587s1c1
Sequence:CCGGGCTGAGATGTTCCTTAGTAATCTCGAGATTACTAAGGAACATCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020120.x-1441s1c1
Sequence:CCGGGCAGATATAATTCGTGGCCTTCTCGAGAAGGCCACGAATTATATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020120.x-750s1c1
Sequence:CCGGCCTGTTTACCTCTCTGGCTATCTCGAGATAGCCAGAGAGGTAAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004524    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020120.x-4891s1c1
Sequence:CCGGCTCTGTTGGATTTGTACCTCACTCGAGTGAGGTACAAATCCAACAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020120.x-2433s1c1
Sequence:CCGGCCTGCCAAAGAGATAAGCTATCTCGAGATAGCTTATCTCTTTGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020120.3-1826s21c1
Sequence:CCGGGCTGTTCTTAGAGCATATAATCTCGAGATTATATGCTCTAAGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020120.3-2327s21c1
Sequence:CCGGGTGGATGATTATGCTAGATTTCTCGAGAAATCTAGCATAATCATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020120.3-4556s21c1
Sequence:CCGGATTCATCAGGTGCCAATTAAACTCGAGTTTAATTGGCACCTGATGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020120
UGGT1 MISSION shRNA shRNA Plasmid DNA
UDP-glucose glycoprotein glucosyltransferase 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020120.x-1587s1c1
Sequence:CCGGGCTGAGATGTTCCTTAGTAATCTCGAGATTACTAAGGAACATCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020120.x-1441s1c1
Sequence:CCGGGCAGATATAATTCGTGGCCTTCTCGAGAAGGCCACGAATTATATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020120.x-750s1c1
Sequence:CCGGCCTGTTTACCTCTCTGGCTATCTCGAGATAGCCAGAGAGGTAAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004524    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020120.x-4891s1c1
Sequence:CCGGCTCTGTTGGATTTGTACCTCACTCGAGTGAGGTACAAATCCAACAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020120.x-2433s1c1
Sequence:CCGGCCTGCCAAAGAGATAAGCTATCTCGAGATAGCTTATCTCTTTGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020120.3-1826s21c1
Sequence:CCGGGCTGTTCTTAGAGCATATAATCTCGAGATTATATGCTCTAAGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020120.3-2327s21c1
Sequence:CCGGGTGGATGATTATGCTAGATTTCTCGAGAAATCTAGCATAATCATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020120.3-4556s21c1
Sequence:CCGGATTCATCAGGTGCCAATTAAACTCGAGTTTAATTGGCACCTGATGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020120
UGGT1 MISSION shRNA Lentiviral Transduction Particles
UDP-glucose glycoprotein glucosyltransferase 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020120.x-1587s1c1
Sequence:CCGGGCTGAGATGTTCCTTAGTAATCTCGAGATTACTAAGGAACATCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020120.x-1441s1c1
Sequence:CCGGGCAGATATAATTCGTGGCCTTCTCGAGAAGGCCACGAATTATATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020120.x-750s1c1
Sequence:CCGGCCTGTTTACCTCTCTGGCTATCTCGAGATAGCCAGAGAGGTAAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004524    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020120.x-4891s1c1
Sequence:CCGGCTCTGTTGGATTTGTACCTCACTCGAGTGAGGTACAAATCCAACAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020120.x-2433s1c1
Sequence:CCGGCCTGCCAAAGAGATAAGCTATCTCGAGATAGCTTATCTCTTTGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020120.3-1826s21c1
Sequence:CCGGGCTGTTCTTAGAGCATATAATCTCGAGATTATATGCTCTAAGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020120.3-2327s21c1
Sequence:CCGGGTGGATGATTATGCTAGATTTCTCGAGAAATCTAGCATAATCATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020120.3-4556s21c1
Sequence:CCGGATTCATCAGGTGCCAATTAAACTCGAGTTTAATTGGCACCTGATGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks