EMAIL THIS PAGE TO A FRIEND

UGGT2

UDP-glucose glycoprotein glucosyltransferase 2

Synonyms: HUGT2 UGCGL2 UGT2
UniProtKB ID: Q9NYU1, Q08AD0, Q5JQR8, Q9UFC4
Gene ID:
Human(55757) Summary: UDP-glucose:glycoprotein glucosyltransferase (UGT) is a soluble protein of the endoplasmic reticulum (ER) that selectively reglucosylates unfolded glycoproteins, thus providing quality control for protein transport out of the ER.[supplied by OMIM, Oct 2009]
Mouse(66435) UDP-glucose glycoprotein glucosyltransferase 2
cow(516399) UDP-glucose glycoprotein glucosyltransferase 2
sheep(101108761) UDP-glucose glycoprotein glucosyltransferase 2
domestic guinea pig(100716858) UDP-glucose glycoprotein glucosyltransferase 2
naked mole-rat(101718003) UDP-glucose glycoprotein glucosyltransferase 2
Zebrafish(497542) UDP-glucose glycoprotein glucosyltransferase 2
chicken(418785) UDP-glucose glycoprotein glucosyltransferase 2
dog(485525) UDP-glucose glycoprotein glucosyltransferase 2
domestic cat(101099423) UDP-glucose glycoprotein glucosyltransferase 2
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081252 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081252 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081252 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020121 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020121 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020121 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU029521 MISSION® esiRNA esiRNA human UGCGL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020121 Rosetta Predictions human pricing
NM_001081252 Rosetta Predictions mouse pricing
XM_001004641 Rosetta Predictions mouse pricing
XM_001004643 Rosetta Predictions mouse pricing
XM_001004644 Rosetta Predictions mouse pricing
XM_619288 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020121 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189468 predicted 3651
2 SASI_Hs01_00189470 predicted 1825
3 SASI_Hs01_00189471 predicted 1398
4 SASI_Hs02_00352981 predicted 471
5 SASI_Hs01_00189472 predicted 4163
6 SASI_Hs01_00189473 predicted 3554
7 SASI_Hs01_00189474 predicted 728
8 SASI_Hs01_00189475 predicted 3013
9 SASI_Hs01_00189476 predicted 3929
10 SASI_Hs02_00352982 predicted 2169
11 SASI_Hs01_00189469 predicted 3290
12 SASI_Hs01_00189477 predicted 708
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081252 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296657 predicted 314
2 SASI_Mm02_00296658 predicted 4509
3 SASI_Mm02_00296659 predicted 1706
4 SASI_Mm02_00296660 predicted 600
5 SASI_Mm02_00296661 predicted 2138
6 SASI_Mm02_00296662 predicted 2368
7 SASI_Mm02_00296663 predicted 4538
8 SASI_Mm02_00296664 predicted 4215
9 SASI_Mm02_00296665 predicted 3965
10 SASI_Mm02_00296666 predicted 3122
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004641 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00271092 predicted 321
2 SASI_Mm01_00271093 predicted 1706
3 SASI_Mm01_00271094 predicted 599
4 SASI_Mm01_00271095 predicted 2152
5 SASI_Mm01_00271096 predicted 2240
6 SASI_Mm01_00271097 predicted 2370
7 SASI_Mm01_00271098 predicted 418
8 SASI_Mm01_00271099 predicted 1837
9 SASI_Mm01_00271100 predicted 2101
10 SASI_Mm01_00271101 predicted 480
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004643 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00264994 predicted 4563
2 SASI_Mm01_00264995 predicted 5119
3 SASI_Mm01_00264996 predicted 4634
4 SASI_Mm01_00264997 predicted 4727
5 SASI_Mm01_00264998 predicted 4599
6 SASI_Mm01_00264999 predicted 5056
7 SASI_Mm01_00265000 predicted 4670
8 SASI_Mm01_00265001 predicted 4987
9 SASI_Mm01_00265002 predicted 4726
10 SASI_Mm01_00265003 predicted 4913
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004644 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00217445 predicted 4509
2 SASI_Mm01_00217446 predicted 5072
3 SASI_Mm01_00217447 predicted 4587
4 SASI_Mm01_00217448 predicted 4679
5 SASI_Mm01_00217449 predicted 4546
6 SASI_Mm01_00217450 predicted 5007
7 SASI_Mm01_00217451 predicted 4621
8 SASI_Mm01_00217452 predicted 4931
9 SASI_Mm01_00217453 predicted 4675
10 SASI_Mm01_00217454 predicted 4861
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_619288 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00246985 predicted 4557
2 SASI_Mm01_00246986 predicted 5121
3 SASI_Mm01_00246987 predicted 4627
4 SASI_Mm01_00246988 predicted 4735
5 SASI_Mm01_00246989 predicted 4592
6 SASI_Mm01_00246990 predicted 5046
7 SASI_Mm01_00246991 predicted 4672
8 SASI_Mm01_00246992 predicted 4989
9 SASI_Mm01_00246993 predicted 4717
10 SASI_Mm01_00246994 predicted 4907
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081252
UGGT2 MISSION shRNA Bacterial Glycerol Stock
UDP-glucose glycoprotein glucosyltransferase 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081252.2-762s21c1
Sequence:CCGGTGGCGTGGAGCTAGCAATTAACTCGAGTTAATTGCTAGCTCCACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081252.2-824s21c1
Sequence:CCGGCTACGACTGATACTGATATAGCTCGAGCTATATCAGTATCAGTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081252.2-5203s21c1
Sequence:CCGGATAGGGTAAAGGACGTTAAACCTCGAGGTTTAACGTCCTTTACCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081252.2-2159s21c1
Sequence:CCGGCATCGGTAACTGCTGATATTGCTCGAGCAATATCAGCAGTTACCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081252.2-2617s21c1
Sequence:CCGGTTCCGGACTCACCAGTTATTCCTCGAGGAATAACTGGTGAGTCCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081252
UGGT2 MISSION shRNA shRNA Plasmid DNA
UDP-glucose glycoprotein glucosyltransferase 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081252.2-762s21c1
Sequence:CCGGTGGCGTGGAGCTAGCAATTAACTCGAGTTAATTGCTAGCTCCACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081252.2-824s21c1
Sequence:CCGGCTACGACTGATACTGATATAGCTCGAGCTATATCAGTATCAGTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081252.2-5203s21c1
Sequence:CCGGATAGGGTAAAGGACGTTAAACCTCGAGGTTTAACGTCCTTTACCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081252.2-2159s21c1
Sequence:CCGGCATCGGTAACTGCTGATATTGCTCGAGCAATATCAGCAGTTACCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081252.2-2617s21c1
Sequence:CCGGTTCCGGACTCACCAGTTATTCCTCGAGGAATAACTGGTGAGTCCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081252
UGGT2 MISSION shRNA Lentiviral Transduction Particles
UDP-glucose glycoprotein glucosyltransferase 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081252.2-762s21c1
Sequence:CCGGTGGCGTGGAGCTAGCAATTAACTCGAGTTAATTGCTAGCTCCACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081252.2-824s21c1
Sequence:CCGGCTACGACTGATACTGATATAGCTCGAGCTATATCAGTATCAGTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081252.2-5203s21c1
Sequence:CCGGATAGGGTAAAGGACGTTAAACCTCGAGGTTTAACGTCCTTTACCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081252.2-2159s21c1
Sequence:CCGGCATCGGTAACTGCTGATATTGCTCGAGCAATATCAGCAGTTACCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081252.2-2617s21c1
Sequence:CCGGTTCCGGACTCACCAGTTATTCCTCGAGGAATAACTGGTGAGTCCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020121
VALIDATED
UGGT2 MISSION shRNA Bacterial Glycerol Stock
UDP-glucose glycoprotein glucosyltransferase 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020121.2-1689s1c1
Sequence:CCGGGCTTTCAACTATATTGCAGAACTCGAGTTCTGCAATATAGTTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036154    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020121.2-4630s1c1
Sequence:CCGGGTATATGAGAAGGAAGGCGAACTCGAGTTCGCCTTCCTTCTCATATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020121.2-4548s1c1
Sequence:CCGGGCTGAGATAAGACAACTATTACTCGAGTAATAGTTGTCTTATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020121.2-3015s1c1
Sequence:CCGGGCACAGTTGTTGGTTGTACTTCTCGAGAAGTACAACCAACAACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020121.2-1041s1c1
Sequence:CCGGCCAGTTTATGATGCCATTAAACTCGAGTTTAATGGCATCATAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020121
VALIDATED
UGGT2 MISSION shRNA shRNA Plasmid DNA
UDP-glucose glycoprotein glucosyltransferase 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020121.2-1689s1c1
Sequence:CCGGGCTTTCAACTATATTGCAGAACTCGAGTTCTGCAATATAGTTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036154    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020121.2-4630s1c1
Sequence:CCGGGTATATGAGAAGGAAGGCGAACTCGAGTTCGCCTTCCTTCTCATATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020121.2-4548s1c1
Sequence:CCGGGCTGAGATAAGACAACTATTACTCGAGTAATAGTTGTCTTATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020121.2-3015s1c1
Sequence:CCGGGCACAGTTGTTGGTTGTACTTCTCGAGAAGTACAACCAACAACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020121.2-1041s1c1
Sequence:CCGGCCAGTTTATGATGCCATTAAACTCGAGTTTAATGGCATCATAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020121
VALIDATED
UGGT2 MISSION shRNA Lentiviral Transduction Particles
UDP-glucose glycoprotein glucosyltransferase 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020121.2-1689s1c1
Sequence:CCGGGCTTTCAACTATATTGCAGAACTCGAGTTCTGCAATATAGTTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036154    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020121.2-4630s1c1
Sequence:CCGGGTATATGAGAAGGAAGGCGAACTCGAGTTCGCCTTCCTTCTCATATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020121.2-4548s1c1
Sequence:CCGGGCTGAGATAAGACAACTATTACTCGAGTAATAGTTGTCTTATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020121.2-3015s1c1
Sequence:CCGGGCACAGTTGTTGGTTGTACTTCTCGAGAAGTACAACCAACAACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020121.2-1041s1c1
Sequence:CCGGCCAGTTTATGATGCCATTAAACTCGAGTTTAATGGCATCATAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks