EMAIL THIS PAGE TO A FRIEND

UGP2

UDP-glucose pyrophosphorylase 2

Synonyms: UDPG UDPGP UDPGP2 UGP1 UGPP1 UGPP2 pHC379
UniProtKB ID: Q16851, Q07131, Q0P6K2, Q86Y81, Q9BU15
Gene ID:
Human(7360) Summary: The enzyme encoded by this gene is an important intermediary in mammalian carbohydrate interconversions. It transfers a glucose moiety from glucose-1-phosphate to MgUTP and forms UDP-glucose and MgPPi. In liver and muscle tissue, UDP-glucose is a direct precursor of glycogen; in lactating mammary gland it is converted to UDP-galactose which is then converted to lactose. The eukaryotic enzyme has no significant sequence similarity to the prokaryotic enzyme. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(216558) UDP-glucose pyrophosphorylase 2
Rat(289827) UDP-glucose pyrophosphorylase 2
Thale Cress(831596) UTP--glucose-1-phosphate uridylyltransferase 1
chicken(373900) UDP-glucose pyrophosphorylase 2
dog(474615) UDP-glucose pyrophosphorylase 2
domestic cat(101081721) UDP-glucose pyrophosphorylase 2
naked mole-rat(101717993) UDP-glucose pyrophosphorylase 2
domestic guinea pig(100729251) UDP-glucose pyrophosphorylase 2
cow(281565) UDP-glucose pyrophosphorylase 2
sheep(101115777) UDP-glucose pyrophosphorylase 2
109 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006759 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006759 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006759 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_139297 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139297 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139297 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001521 Rosetta Predictions human pricing
NM_006759 Rosetta Predictions human pricing
NM_001024743 Rosetta Predictions rat pricing
NM_139297 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001521 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303804 predicted 1070
2 SASI_Hs01_00058230 predicted 708
3 SASI_Hs02_00303805 predicted 1077
4 SASI_Hs01_00058231 predicted 1735
5 SASI_Hs01_00058232 predicted 540
6 SASI_Hs01_00058233 predicted 1754
7 SASI_Hs01_00058234 predicted 671
8 SASI_Hs01_00058235 predicted 1718
9 SASI_Hs01_00058237 predicted 1669
10 SASI_Hs01_00058238 predicted 961
11 SASI_Hs01_00058229 predicted 1810
12 SASI_Hs01_00058236 predicted 680
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006759 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342246 predicted 1128
2 SASI_Hs01_00116611 predicted 758
3 SASI_Hs02_00342247 predicted 1125
4 SASI_Hs01_00116612 predicted 1788
5 SASI_Hs01_00116613 predicted 598
6 SASI_Hs01_00116614 predicted 1810
7 SASI_Hs01_00116615 predicted 724
8 SASI_Hs01_00116616 predicted 1776
9 SASI_Hs01_00116618 predicted 1723
10 SASI_Hs01_00116619 predicted 1012
11 SASI_Hs01_00116610 predicted 1866
12 SASI_Hs01_00116617 predicted 727
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024743 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202616 predicted 1015
2 SASI_Rn01_00080942 predicted 1384
3 SASI_Rn01_00080943 predicted 1574
4 SASI_Rn01_00080944 predicted 1856
5 SASI_Rn01_00080946 predicted 1324
6 SASI_Rn01_00080947 predicted 1285
7 SASI_Rn01_00080948 predicted 1481
8 SASI_Rn01_00080949 predicted 318
9 SASI_Rn01_00080950 predicted 1560
10 SASI_Rn01_00080951 predicted 536
11 SASI_Rn01_00080945 predicted 1081
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139297 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087394 predicted 931
2 SASI_Mm01_00087395 predicted 556
3 SASI_Mm01_00087396 predicted 1400
4 SASI_Mm01_00087397 predicted 1460
5 SASI_Mm02_00339984 predicted 1602
6 SASI_Mm01_00087398 predicted 790
7 SASI_Mm01_00087399 predicted 347
8 SASI_Mm01_00087400 predicted 861
9 SASI_Mm01_00087402 predicted 1488
10 SASI_Mm01_00087403 predicted 579
11 SASI_Mm01_00087401 predicted 1586
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006759
VALIDATED
UGP2 MISSION shRNA Bacterial Glycerol Stock
UDP-glucose pyrophosphorylase 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006759.2-1123s1c1
Sequence:CCGGGCCATTGACATGGAAATCATTCTCGAGAATGATTTCCATGTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006759.2-206s1c1
Sequence:CCGGCCACAGCATCATCACATGAATCTCGAGATTCATGTGATGATGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006759.2-983s1c1
Sequence:CCGGGCAAACTGAGACTGGTGGAAACTCGAGTTTCCACCAGTCTCAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006759.2-853s1c1
Sequence:CCGGGCCACAGTGGATCTGTATATTCTCGAGAATATACAGATCCACTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006759.2-1558s1c1
Sequence:CCGGGCAGTATTAGAGAACAAGATACTCGAGTATCTTGTTCTCTAATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435330    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006759.3-1866s21c1
Sequence:CCGGGCTAGTTTCTTACAATGAAATCTCGAGATTTCATTGTAAGAAACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006759.3-378s21c1
Sequence:CCGGTCGGCAAGAGCTAGAATTATCCTCGAGGATAATTCTAGCTCTTGCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006759.3-473s21c1
Sequence:CCGGATGGATTTCGGAAGCTATTTCCTCGAGGAAATAGCTTCCGAAATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006759
VALIDATED
UGP2 MISSION shRNA shRNA Plasmid DNA
UDP-glucose pyrophosphorylase 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006759.2-1123s1c1
Sequence:CCGGGCCATTGACATGGAAATCATTCTCGAGAATGATTTCCATGTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006759.2-206s1c1
Sequence:CCGGCCACAGCATCATCACATGAATCTCGAGATTCATGTGATGATGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006759.2-983s1c1
Sequence:CCGGGCAAACTGAGACTGGTGGAAACTCGAGTTTCCACCAGTCTCAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006759.2-853s1c1
Sequence:CCGGGCCACAGTGGATCTGTATATTCTCGAGAATATACAGATCCACTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006759.2-1558s1c1
Sequence:CCGGGCAGTATTAGAGAACAAGATACTCGAGTATCTTGTTCTCTAATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435330    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006759.3-1866s21c1
Sequence:CCGGGCTAGTTTCTTACAATGAAATCTCGAGATTTCATTGTAAGAAACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006759.3-378s21c1
Sequence:CCGGTCGGCAAGAGCTAGAATTATCCTCGAGGATAATTCTAGCTCTTGCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006759.3-473s21c1
Sequence:CCGGATGGATTTCGGAAGCTATTTCCTCGAGGAAATAGCTTCCGAAATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006759
VALIDATED
UGP2 MISSION shRNA Lentiviral Transduction Particles
UDP-glucose pyrophosphorylase 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006759.2-1123s1c1
Sequence:CCGGGCCATTGACATGGAAATCATTCTCGAGAATGATTTCCATGTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006759.2-206s1c1
Sequence:CCGGCCACAGCATCATCACATGAATCTCGAGATTCATGTGATGATGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006759.2-983s1c1
Sequence:CCGGGCAAACTGAGACTGGTGGAAACTCGAGTTTCCACCAGTCTCAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006759.2-853s1c1
Sequence:CCGGGCCACAGTGGATCTGTATATTCTCGAGAATATACAGATCCACTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006759.2-1558s1c1
Sequence:CCGGGCAGTATTAGAGAACAAGATACTCGAGTATCTTGTTCTCTAATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435330    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006759.3-1866s21c1
Sequence:CCGGGCTAGTTTCTTACAATGAAATCTCGAGATTTCATTGTAAGAAACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006759.3-378s21c1
Sequence:CCGGTCGGCAAGAGCTAGAATTATCCTCGAGGATAATTCTAGCTCTTGCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006759.3-473s21c1
Sequence:CCGGATGGATTTCGGAAGCTATTTCCTCGAGGAAATAGCTTCCGAAATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139297
UGP2 MISSION shRNA Bacterial Glycerol Stock
UDP-glucose pyrophosphorylase 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000025378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139297.2-332s1c1
Sequence:CCGGCAAGAGGTCATTCTCCAAGAACTCGAGTTCTTGGAGAATGACCTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139297.2-1581s1c1
Sequence:CCGGCCAAGGTTCAAGATTATCTAACTCGAGTTAGATAATCTTGAACCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139297.2-1040s1c1
Sequence:CCGGGCCACAGTGGATCTTTATATTCTCGAGAATATAAAGATCCACTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139297.2-558s1c1
Sequence:CCGGGCTTGCCTGATAACATATCTTCTCGAGAAGATATGTTATCAGGCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139297
UGP2 MISSION shRNA shRNA Plasmid DNA
UDP-glucose pyrophosphorylase 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000025378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139297.2-332s1c1
Sequence:CCGGCAAGAGGTCATTCTCCAAGAACTCGAGTTCTTGGAGAATGACCTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139297.2-1581s1c1
Sequence:CCGGCCAAGGTTCAAGATTATCTAACTCGAGTTAGATAATCTTGAACCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139297.2-1040s1c1
Sequence:CCGGGCCACAGTGGATCTTTATATTCTCGAGAATATAAAGATCCACTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139297.2-558s1c1
Sequence:CCGGGCTTGCCTGATAACATATCTTCTCGAGAAGATATGTTATCAGGCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139297
UGP2 MISSION shRNA Lentiviral Transduction Particles
UDP-glucose pyrophosphorylase 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000025378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139297.2-332s1c1
Sequence:CCGGCAAGAGGTCATTCTCCAAGAACTCGAGTTCTTGGAGAATGACCTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139297.2-1581s1c1
Sequence:CCGGCCAAGGTTCAAGATTATCTAACTCGAGTTAGATAATCTTGAACCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139297.2-1040s1c1
Sequence:CCGGGCCACAGTGGATCTTTATATTCTCGAGAATATAAAGATCCACTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139297.2-558s1c1
Sequence:CCGGGCTTGCCTGATAACATATCTTCTCGAGAAGATATGTTATCAGGCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks