EMAIL THIS PAGE TO A FRIEND

UGT1A10

UDP glucuronosyltransferase 1 family, polypeptide A10

Synonyms: UDPGT UGT-1J UGT1-10 UGT1.10 UGT1J
Species: Human UGT1A10(54575), Mouse Ugt1a10(394430), domestic guinea pig Ugt1a10(100721632)
UniProtKB ID: Q9HAW8, O00474, Q6NT91
Gene ID:
Human(54575) Summary: This gene encodes a UDP-glucuronosyltransferase, an enzyme of the glucuronidation pathway that transforms small lipophilic molecules, such as steroids, bilirubin, hormones, and drugs, into water-soluble, excretable metabolites. This gene is part of a complex locus that encodes several UDP-glucuronosyltransferases. The locus includes thirteen unique alternate first exons followed by four common exons. Four of the alternate first exons are considered pseudogenes. Each of the remaining nine 5' exons may be spliced to the four common exons, resulting in nine proteins with different N-termini and identical C-termini. Each first exon encodes the substrate binding site, and is regulated by its own promoter. The enzyme encoded by this gene has glucuronidase activity on mycophenolic acid, coumarins, and quinolines. [provided by RefSeq, Jul 2008]
Mouse(394430) UDP glycosyltransferase 1 family, polypeptide A10
domestic guinea pig(100721632) UDP glucuronosyltransferase 1 family, polypeptide A10
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019075 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019075 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019075 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_201641 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_201641 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_201641 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019075 Rosetta Predictions human pricing
NM_201641 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019075 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236936 predicted 2110
2 SASI_Hs01_00236937 predicted 1697
3 SASI_Hs01_00236939 predicted 2035
4 SASI_Hs02_00352668 predicted 1941
5 SASI_Hs01_00236940 predicted 1560
6 SASI_Hs01_00236941 predicted 2031
7 SASI_Hs01_00236942 predicted 2120
8 SASI_Hs01_00236943 predicted 2045
9 SASI_Hs01_00236945 predicted 2108
10 SASI_Hs02_00352669 predicted 1610
11 SASI_Hs01_00236938 predicted 1599
12 SASI_Hs01_00236944 predicted 1553
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201641 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00351713 predicted 1180
2 SASI_Mm02_00351714 predicted 1360
3 SASI_Mm01_00101902 predicted 1181
4 SASI_Mm02_00351715 predicted 1417
5 SASI_Mm02_00351716 predicted 1398
6 SASI_Mm02_00351717 predicted 1289
7 SASI_Mm02_00351718 predicted 1203
8 SASI_Mm02_00351719 predicted 1201
9 SASI_Mm02_00351720 predicted 1189
10 SASI_Mm02_00351721 predicted 1252
11 SASI_Mm01_00101896 predicted 1858
12 SASI_Mm01_00101897 predicted 1848
13 SASI_Mm01_00101898 predicted 1926
14 SASI_Mm01_00101899 predicted 1879
15 SASI_Mm01_00101900 predicted 1802
16 SASI_Mm01_00101901 predicted 1879
17 SASI_Mm01_00101903 predicted 1173
18 SASI_Mm01_00101904 predicted 1144
19 SASI_Mm01_00101905 predicted 1881
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019075
UGT1A10 MISSION shRNA Bacterial Glycerol Stock
UDP glucuronosyltransferase 1 family, polypeptide A10
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019075.2-344s1c1
Sequence:CCGGGCACAGGCACAAAGTATATTTCTCGAGAAATATACTTTGTGCCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019075.2-890s1c1
Sequence:CCGGCCATTGCCTATGGAATTTGAACTCGAGTTCAAATTCCATAGGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019075.2-412s1c1
Sequence:CCGGGCATTGCAGGAGTTTGTTTAACTCGAGTTAAACAAACTCCTGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019075.2-1552s1c1
Sequence:CCGGCACCTTTAAATGTTGTGCTTACTCGAGTAAGCACAACATTTAAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019075.2-238s1c1
Sequence:CCGGGCAACTGGAAAGATCACTGAACTCGAGTTCAGTGATCTTTCCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019075.2-372s21c1
Sequence:CCGGTAATGAGTTCATCCAGTGGTTCTCGAGAACCACTGGATGAACTCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019075.2-781s21c1
Sequence:CCGGCAGTCACACATCAATTTGGTTCTCGAGAACCAAATTGATGTGTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019075
UGT1A10 MISSION shRNA shRNA Plasmid DNA
UDP glucuronosyltransferase 1 family, polypeptide A10
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019075.2-344s1c1
Sequence:CCGGGCACAGGCACAAAGTATATTTCTCGAGAAATATACTTTGTGCCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019075.2-890s1c1
Sequence:CCGGCCATTGCCTATGGAATTTGAACTCGAGTTCAAATTCCATAGGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019075.2-412s1c1
Sequence:CCGGGCATTGCAGGAGTTTGTTTAACTCGAGTTAAACAAACTCCTGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019075.2-1552s1c1
Sequence:CCGGCACCTTTAAATGTTGTGCTTACTCGAGTAAGCACAACATTTAAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019075.2-238s1c1
Sequence:CCGGGCAACTGGAAAGATCACTGAACTCGAGTTCAGTGATCTTTCCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019075.2-372s21c1
Sequence:CCGGTAATGAGTTCATCCAGTGGTTCTCGAGAACCACTGGATGAACTCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019075.2-781s21c1
Sequence:CCGGCAGTCACACATCAATTTGGTTCTCGAGAACCAAATTGATGTGTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019075
UGT1A10 MISSION shRNA Lentiviral Transduction Particles
UDP glucuronosyltransferase 1 family, polypeptide A10
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019075.2-344s1c1
Sequence:CCGGGCACAGGCACAAAGTATATTTCTCGAGAAATATACTTTGTGCCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019075.2-890s1c1
Sequence:CCGGCCATTGCCTATGGAATTTGAACTCGAGTTCAAATTCCATAGGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019075.2-412s1c1
Sequence:CCGGGCATTGCAGGAGTTTGTTTAACTCGAGTTAAACAAACTCCTGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019075.2-1552s1c1
Sequence:CCGGCACCTTTAAATGTTGTGCTTACTCGAGTAAGCACAACATTTAAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019075.2-238s1c1
Sequence:CCGGGCAACTGGAAAGATCACTGAACTCGAGTTCAGTGATCTTTCCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019075.2-372s21c1
Sequence:CCGGTAATGAGTTCATCCAGTGGTTCTCGAGAACCACTGGATGAACTCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019075.2-781s21c1
Sequence:CCGGCAGTCACACATCAATTTGGTTCTCGAGAACCAAATTGATGTGTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201641
UGT1A10 MISSION shRNA Bacterial Glycerol Stock
UDP glucuronosyltransferase 1 family, polypeptide A10
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110345    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201641.1-1673s1c1
Sequence:CCGGGAAACTTGGAAACAAGTGTTACTCGAGTAACACTTGTTTCCAAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201641.1-503s1c1
Sequence:CCGGCCAAGTATCTGTCACTCCCATCTCGAGATGGGAGTGACAGATACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201641.1-769s1c1
Sequence:CCGGCCAGTGTCTATTTGGTTGTTACTCGAGTAACAACCAAATAGACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201641.1-360s1c1
Sequence:CCGGAGGCTCAGCTAGAGGTTTCTTCTCGAGAAGAAACCTCTAGCTGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201641.1-577s1c1
Sequence:CCGGTGCCCGAGTCTTCTTTCTTATCTCGAGATAAGAAAGAAGACTCGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000450982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201641.2-518s21c1
Sequence:CCGGTTTCGATGTATGTGGATTAATCTCGAGATTAATCCACATACATCGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000451001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201641.2-375s21c1
Sequence:CCGGGAACAAAGTATACGTTCTTTCCTCGAGGAAAGAACGTATACTTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201641
UGT1A10 MISSION shRNA shRNA Plasmid DNA
UDP glucuronosyltransferase 1 family, polypeptide A10
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110345    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201641.1-1673s1c1
Sequence:CCGGGAAACTTGGAAACAAGTGTTACTCGAGTAACACTTGTTTCCAAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201641.1-503s1c1
Sequence:CCGGCCAAGTATCTGTCACTCCCATCTCGAGATGGGAGTGACAGATACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201641.1-769s1c1
Sequence:CCGGCCAGTGTCTATTTGGTTGTTACTCGAGTAACAACCAAATAGACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201641.1-360s1c1
Sequence:CCGGAGGCTCAGCTAGAGGTTTCTTCTCGAGAAGAAACCTCTAGCTGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201641.1-577s1c1
Sequence:CCGGTGCCCGAGTCTTCTTTCTTATCTCGAGATAAGAAAGAAGACTCGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000450982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201641.2-518s21c1
Sequence:CCGGTTTCGATGTATGTGGATTAATCTCGAGATTAATCCACATACATCGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000451001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201641.2-375s21c1
Sequence:CCGGGAACAAAGTATACGTTCTTTCCTCGAGGAAAGAACGTATACTTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201641
UGT1A10 MISSION shRNA Lentiviral Transduction Particles
UDP glucuronosyltransferase 1 family, polypeptide A10
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110345    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201641.1-1673s1c1
Sequence:CCGGGAAACTTGGAAACAAGTGTTACTCGAGTAACACTTGTTTCCAAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201641.1-503s1c1
Sequence:CCGGCCAAGTATCTGTCACTCCCATCTCGAGATGGGAGTGACAGATACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201641.1-769s1c1
Sequence:CCGGCCAGTGTCTATTTGGTTGTTACTCGAGTAACAACCAAATAGACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201641.1-360s1c1
Sequence:CCGGAGGCTCAGCTAGAGGTTTCTTCTCGAGAAGAAACCTCTAGCTGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201641.1-577s1c1
Sequence:CCGGTGCCCGAGTCTTCTTTCTTATCTCGAGATAAGAAAGAAGACTCGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000450982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201641.2-518s21c1
Sequence:CCGGTTTCGATGTATGTGGATTAATCTCGAGATTAATCCACATACATCGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000451001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201641.2-375s21c1
Sequence:CCGGGAACAAAGTATACGTTCTTTCCTCGAGGAAAGAACGTATACTTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks