EMAIL THIS PAGE TO A FRIEND

UGT1A1

UDP glucuronosyltransferase 1 family, polypeptide A1

Synonyms: BILIQTL1 GNT1 HUG-BR1 UDPGT UDPGT 1-1 UGT1 UGT1A
UniProtKB ID: P22309
Gene ID:
Human(54658) Summary: This gene encodes a UDP-glucuronosyltransferase, an enzyme of the glucuronidation pathway that transforms small lipophilic molecules, such as steroids, bilirubin, hormones, and drugs, into water-soluble, excretable metabolites. This gene is part of a complex locus that encodes several UDP-glucuronosyltransferases. The locus includes thirteen unique alternate first exons followed by four common exons. Four of the alternate first exons are considered pseudogenes. Each of the remaining nine 5' exons may be spliced to the four common exons, resulting in nine proteins with different N-termini and identical C-termini. Each first exon encodes the substrate binding site, and is regulated by its own promoter. The preferred substrate of this enzyme is bilirubin, although it also has moderate activity with simple phenols, flavones, and C18 steroids. Mutations in this gene result in Crigler-Najjar syndromes types I and II and in Gilbert syndrome. [provided by RefSeq, Jul 2008]
Mouse(394436) UDP glucuronosyltransferase 1 family, polypeptide A1
Rat(24861) UDP glucuronosyltransferase 1 family, polypeptide A1
Zebrafish(641488) UDP glucuronosyltransferase 1 family polypeptide a1
chicken(424028) UDP glucuronosyltransferase 1 family, polypeptide A1
Horse(100065342) UDP glucuronosyltransferase 1 family, polypeptide A1
domestic cat(493955) UDP glucuronosyltransferase 1 family, polypeptide A1
cow(751790) UDP glucuronosyltransferase 1 family, polypeptide A1
sheep(100534644) UDP glucuronosyltransferase 1 family, polypeptide A1
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108583 Anti-UGT1A1 IgG fraction of antiserum human, horse, sheep, rat, human, rabbit, bovine, pig
western blot pricing
SAB2108737 Anti-UGT1A1 affinity isolated antibody rat, human, horse, mouse
western blot pricing
AV44294 Anti-UGT1A1 antibody produced in rabbit IgG fraction of antiserum rabbit, mouse, rabbit, horse, canine, rat, human, sheep
western blot pricing
SAB2102640 Anti-UGT1A1 antibody produced in rabbit affinity isolated antibody human, horse, mouse, rat
western blot pricing
SAB2701158 Anti-UGT1A1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000463 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000463 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000463 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_201645 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_201645 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_201645 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000463 Rosetta Predictions human pricing
NM_012683 Rosetta Predictions rat pricing
NM_201645 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000463 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185963 predicted 2089
2 SASI_Hs01_00185964 predicted 1680
3 SASI_Hs01_00185966 predicted 2011
4 SASI_Hs02_00302608 predicted 1920
5 SASI_Hs01_00185967 predicted 1538
6 SASI_Hs01_00185968 predicted 2004
7 SASI_Hs01_00185969 predicted 2096
8 SASI_Hs01_00185970 predicted 2027
9 SASI_Hs01_00185972 predicted 2085
10 SASI_Hs02_00302609 predicted 1588
11 SASI_Hs01_00185965 predicted 1586
12 SASI_Hs01_00185971 predicted 1536
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012683 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118604 predicted 1480
2 SASI_Rn01_00118605 predicted 1452
3 SASI_Rn01_00118606 predicted 1263
4 SASI_Rn01_00118607 predicted 1518
5 SASI_Rn01_00118608 predicted 1394
6 SASI_Rn02_00259979 predicted 1142
7 SASI_Rn02_00259980 predicted 1134
8 SASI_Rn01_00118609 predicted 1143
9 SASI_Rn01_00118610 predicted 1261
10 SASI_Rn02_00259981 predicted 1123
11 SASI_Rn01_00118611 predicted 1257
12 SASI_Rn01_00118612 predicted 2027
13 SASI_Rn01_00118613 predicted 1184
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201645 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00351748 predicted 1344
2 SASI_Mm02_00351749 predicted 1165
3 SASI_Mm01_00080170 predicted 1406
4 SASI_Mm02_00351750 predicted 1164
5 SASI_Mm01_00080171 predicted 1388
6 SASI_Mm02_00351751 predicted 1279
7 SASI_Mm02_00351752 predicted 1193
8 SASI_Mm02_00351753 predicted 1188
9 SASI_Mm02_00351754 predicted 1174
10 SASI_Mm02_00351755 predicted 1236
11 SASI_Mm01_00080169 predicted 1425
12 SASI_Mm01_00080172 predicted 1419
13 SASI_Mm01_00080173 predicted 1478
14 SASI_Mm01_00080174 predicted 1438
15 SASI_Mm01_00080175 predicted 1464
16 SASI_Mm01_00080176 predicted 1419
17 SASI_Mm01_00080177 predicted 1469
18 SASI_Mm01_00080178 predicted 1380
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000463
UGT1A1 MISSION shRNA Bacterial Glycerol Stock
UDP glucuronosyltransferase 1 family, polypeptide A1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000463.2-739s21c1
Sequence:CCGGGTGACTGTCCAGGACCTATTGCTCGAGCAATAGGTCCTGGACAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000463.2-675s21c1
Sequence:CCGGCTTTCTGTGCGACGTGGTTTACTCGAGTAAACCACGTCGCACAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000463.2-514s1c1
Sequence:CCGGCCCACTGTATTCTTCTTGCATCTCGAGATGCAAGAAGAATACAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000463.2-1582s1c1
Sequence:CCGGCGAGTTAAGAAAGCCCACAAACTCGAGTTTGTGGGCTTTCTTAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000463.2-90s1c1
Sequence:CCGGCCATGCTGGGAAGATACTGTTCTCGAGAACAGTATCTTCCCAGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000463.2-774s1c1
Sequence:CCGGCTGGCTGTTTAGAAGTGACTTCTCGAGAAGTCACTTCTAAACAGCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000463.2-640s1c1
Sequence:CCGGCGGGTGAAGAACATGCTCATTCTCGAGAATGAGCATGTTCTTCACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000463
UGT1A1 MISSION shRNA shRNA Plasmid DNA
UDP glucuronosyltransferase 1 family, polypeptide A1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000463.2-739s21c1
Sequence:CCGGGTGACTGTCCAGGACCTATTGCTCGAGCAATAGGTCCTGGACAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000463.2-675s21c1
Sequence:CCGGCTTTCTGTGCGACGTGGTTTACTCGAGTAAACCACGTCGCACAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000463.2-514s1c1
Sequence:CCGGCCCACTGTATTCTTCTTGCATCTCGAGATGCAAGAAGAATACAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000463.2-1582s1c1
Sequence:CCGGCGAGTTAAGAAAGCCCACAAACTCGAGTTTGTGGGCTTTCTTAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000463.2-90s1c1
Sequence:CCGGCCATGCTGGGAAGATACTGTTCTCGAGAACAGTATCTTCCCAGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000463.2-774s1c1
Sequence:CCGGCTGGCTGTTTAGAAGTGACTTCTCGAGAAGTCACTTCTAAACAGCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000463.2-640s1c1
Sequence:CCGGCGGGTGAAGAACATGCTCATTCTCGAGAATGAGCATGTTCTTCACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000463
UGT1A1 MISSION shRNA Lentiviral Transduction Particles
UDP glucuronosyltransferase 1 family, polypeptide A1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000463.2-739s21c1
Sequence:CCGGGTGACTGTCCAGGACCTATTGCTCGAGCAATAGGTCCTGGACAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000463.2-675s21c1
Sequence:CCGGCTTTCTGTGCGACGTGGTTTACTCGAGTAAACCACGTCGCACAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000463.2-514s1c1
Sequence:CCGGCCCACTGTATTCTTCTTGCATCTCGAGATGCAAGAAGAATACAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000463.2-1582s1c1
Sequence:CCGGCGAGTTAAGAAAGCCCACAAACTCGAGTTTGTGGGCTTTCTTAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000463.2-90s1c1
Sequence:CCGGCCATGCTGGGAAGATACTGTTCTCGAGAACAGTATCTTCCCAGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000463.2-774s1c1
Sequence:CCGGCTGGCTGTTTAGAAGTGACTTCTCGAGAAGTCACTTCTAAACAGCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000463.2-640s1c1
Sequence:CCGGCGGGTGAAGAACATGCTCATTCTCGAGAATGAGCATGTTCTTCACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201645
UGT1A1 MISSION shRNA Bacterial Glycerol Stock
UDP glucuronosyltransferase 1 family, polypeptide A1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201645.2-711s21c1
Sequence:CCGGTTATGTGCAGAGTGGTTTATTCTCGAGAATAAACCACTCTGCACATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201645.2-235s21c1
Sequence:CCGGTGAAGCCTCAATACACATAAACTCGAGTTTATGTGTATTGAGGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201645.2-332s21c1
Sequence:CCGGCTTGGACGGACTGCCTTTAATCTCGAGATTAAAGGCAGTCCGTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201645.2-170s21c1
Sequence:CCGGCTGAGTATGCTTGGAGTTATTCTCGAGAATAACTCCAAGCATACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093944    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201645.1-2005s1c1
Sequence:CCGGCCAGTGTTAGTCATTCTTCATCTCGAGATGAAGAATGACTAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201645.1-548s1c1
Sequence:CCGGCCCACTGTGTACTTCTTGAATCTCGAGATTCAAGAAGTACACAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201645.1-439s1c1
Sequence:CCGGGCTGCACAATGCCGAGTTTATCTCGAGATAAACTCGGCATTGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201645.1-1174s1c1
Sequence:CCGGCCGTGGTATTTATGAAGGAATCTCGAGATTCCTTCATAAATACCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201645.1-133s1c1
Sequence:CCGGGAGGCTGTTAGTGTTCCCTATCTCGAGATAGGGAACACTAACAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201645
UGT1A1 MISSION shRNA shRNA Plasmid DNA
UDP glucuronosyltransferase 1 family, polypeptide A1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201645.2-711s21c1
Sequence:CCGGTTATGTGCAGAGTGGTTTATTCTCGAGAATAAACCACTCTGCACATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201645.2-235s21c1
Sequence:CCGGTGAAGCCTCAATACACATAAACTCGAGTTTATGTGTATTGAGGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201645.2-332s21c1
Sequence:CCGGCTTGGACGGACTGCCTTTAATCTCGAGATTAAAGGCAGTCCGTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201645.2-170s21c1
Sequence:CCGGCTGAGTATGCTTGGAGTTATTCTCGAGAATAACTCCAAGCATACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093944    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201645.1-2005s1c1
Sequence:CCGGCCAGTGTTAGTCATTCTTCATCTCGAGATGAAGAATGACTAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201645.1-548s1c1
Sequence:CCGGCCCACTGTGTACTTCTTGAATCTCGAGATTCAAGAAGTACACAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201645.1-439s1c1
Sequence:CCGGGCTGCACAATGCCGAGTTTATCTCGAGATAAACTCGGCATTGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201645.1-1174s1c1
Sequence:CCGGCCGTGGTATTTATGAAGGAATCTCGAGATTCCTTCATAAATACCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201645.1-133s1c1
Sequence:CCGGGAGGCTGTTAGTGTTCCCTATCTCGAGATAGGGAACACTAACAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201645
UGT1A1 MISSION shRNA Lentiviral Transduction Particles
UDP glucuronosyltransferase 1 family, polypeptide A1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201645.2-711s21c1
Sequence:CCGGTTATGTGCAGAGTGGTTTATTCTCGAGAATAAACCACTCTGCACATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201645.2-235s21c1
Sequence:CCGGTGAAGCCTCAATACACATAAACTCGAGTTTATGTGTATTGAGGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201645.2-332s21c1
Sequence:CCGGCTTGGACGGACTGCCTTTAATCTCGAGATTAAAGGCAGTCCGTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201645.2-170s21c1
Sequence:CCGGCTGAGTATGCTTGGAGTTATTCTCGAGAATAACTCCAAGCATACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093944    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201645.1-2005s1c1
Sequence:CCGGCCAGTGTTAGTCATTCTTCATCTCGAGATGAAGAATGACTAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201645.1-548s1c1
Sequence:CCGGCCCACTGTGTACTTCTTGAATCTCGAGATTCAAGAAGTACACAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201645.1-439s1c1
Sequence:CCGGGCTGCACAATGCCGAGTTTATCTCGAGATAAACTCGGCATTGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201645.1-1174s1c1
Sequence:CCGGCCGTGGTATTTATGAAGGAATCTCGAGATTCCTTCATAAATACCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201645.1-133s1c1
Sequence:CCGGGAGGCTGTTAGTGTTCCCTATCTCGAGATAGGGAACACTAACAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks